Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41D11.6   

sjj_C41D11.6RNAiJA:C41D11.6
PCR_productsjj_C41D11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41D11.6 Source_evidenceePCR1166WS150 Sequence/Annotation Release
Overlaps_Gene C41D11.6 Source_evidenceePCR1166WS150 Sequence/Annotation Release
Chunk_score Abs_score1145
Max_abs_score1145C41D11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI44604654461630
Overlaps_transcriptC41D11.6 Source_evidenceePCR1166WS150 Sequence/Annotation Release
WB_DNA_textsjj_C41D11.61166ggcgtcaataattgcaggatgggttcctctgacattcggtctgttgactgactgcacgacctccgtgaacacttctctccatagaatcgggaaatcatcctctgtgagcacttccggcttcgcctcatctctcaaacgcgctgacatggctcgaacaaccttcactcttcctctgggtgccaacgaacgaatcgcatcatgaattgccttcactgctccattgttgttcgctgaaataataactctttggatattttgatttgaaaattcgatagctgttgcagctaccgccttggttttacccgtgccaaaggcaccatccaatgataaagctccgagcttcaggtcgcaacaagcttgaatgaacgtgctctgttgagctgaacacacgaagttctgatatctgaactccttatgtggatagtttaagccattacttgctatgattggaccaccatttaacgctgcaaaggttgccaaacctttattacgatccaacaccgtatccactggaacaacaggagttgctgctagaaggtgaccatctgcttctttagtttgttttataaggactgcgtcctctccgaccgccaaaatgtgaactgcattatcggccggtctcagaattctgcactcgatcgtggtgatcgcatccgtcgactgcaccgcgtgatcgaccgctgctggcacgaaggttccggctggtgtttcgatcgagaatttggtaccattcttccaattgcacgccttgactggccttccaggatattgaagagcaaaagaaaccttcattgatccttccaattcacgtacgtgttgcaacgtagtttcgtagtggaatttgtcctggttcatattcgaagtgctgatcatggcgctcaatccatgatgtccgagtttccgcactcctctccaagcatcttctgtattcggcgatcttcctgccatgtagtttggaagatgaagaaatgggtaggctttccttgctcccatgattccgaagttgatgacttgtggacgaagatcccatgacttactttgagctgcagtttctcttctcaccacaatgtgtggcgttccaggcaacagtgacttcaggagttgtccaggaatgagcacaggtgtaaacgctactgcatcagctcggtatccttgaggtgcacggt