Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41G6.12   

sjj_C41G6.12RNAiJA:C41G6.12
PCR_productsjj_C41G6.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41G6.12 Source_evidenceePCR648WS150 Sequence/Annotation Release
Overlaps_Gene C41G6.12 Source_evidenceePCR648WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627C41G6.12
Specificity_index0.517
Rel_score1
Map_statusBest_ePCRV1520916615210684
Y75B12B.9 Chunk_score Abs_score585
Specificity_index0.483
Rel_score0.933
Overlaps_transcriptC41G6.12 Source_evidenceePCR648WS150 Sequence/Annotation Release
Overlaps_pseudogene Y75B12B.9 Source_evidenceePCR648WS150 Sequence/Annotation Release
Map_statusBest_ePCRV1520529815206816
WB_DNA_textsjj_C41G6.121519tgcattgaatatgcagtaacgacgttgatggaaaaataatcagaaatagagcacagaggatgtgcatataggttaaagaaaagaagaactaatactgttgaaaacacatgaatacctagaaaaactgataatgagaatacagattagaaaatgtacccgtttccattgaaacctacaaattattgttctctttgtcattaaattgtttactcgggatgggatttgacattggagccttttgcacataatcatggtcaaacgttgttctactttagtttaaatacttggatagattctgaagaagttcttcgctggatgctggctatttgggccggattacacacacttattttatacttcgttgcgattcagtttataaaccgacatttatgccttttgaatgcaaattttgctgcaaaacttgaaggaatttatggatattgtctaatgtcaattccattaattccgggaccaacttttgccttatcaattaaaatagtttcaagagaaacagtatttgataatgaaatgcggtatgaggcacaggaacttgattttaaaaataagaagacatttcagaaatctaatgtttgagacctatagtttggtggtatacaaaatcacgaagttcaacatcacaccatattatcccaatggctcagtacagtgggaaaactttgtagtacttgcaattggatgtttcttcaatgtcattgcctattctatcatcatgtattgtggaatcaaaatgcacttcaatatgcaaaaaatgcttgccagattttcaatggctcagcaaaatatccagaaacagttgctccgtgcattggttgcacagagtattggaccaactatttttctggtttttccagccgtcccttttctcatgagtcctttattgccaccgttgtttgacttgaatatcgacgtacaatctggatggatcttctgcatttttggaagctattcttcgttcgacaccattgttttcatggttattgtaaaatagtaaagaagttgtttaatgagtaaaataaaaaacgaggaagctgagaaaaacttttacaattcccagattatctacacaaagtaggatcgtcagttggaccatcaatgtagaattttggcagtggtgtctcattttgcaatcttcaaataatctaaacttttttcaagacatttttgcatagaagcttagtgaattttctgatattgtttaacgcaatacacgggcaacaataaactgtttattaaatgggatcttccggcgaacgccaaaagatccccacacaaaatgagttcaataagtgagaagacggtcgagcacgaaaaaaaaaactgttgagaactgatgtttcttccgcaatctccttcttatatagttatctgatatgaccttccacgtaaaggtcacaaaggttgtttcacggtttattgtcggtgggtctgtatttctgtccttttgattatagaggctaaagcaaaatatcaagctgtgagactatttggaattgtgcct