Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C41G6.12_b   

sjj_C41G6.12_bSequenceTGCATTGAATATGCAGTAACGAC
In_sequence SUPERLINK_CB_V
Y75B12B
PCR_product sjj_C41G6.12
smd_Y75B12B.9