Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41G7.5   

sjj_C41G7.5RNAiJA:C41G7.5
PCR_productsjj_C41G7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41G7.5a Source_evidenceePCR684WS150 Sequence/Annotation Release
Overlaps_Gene C41G7.5 Source_evidenceePCR684WS150 Sequence/Annotation Release
Chunk_score Abs_score579
Max_abs_score579C41G7.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI95293189530984
Overlaps_transcript C41G7.5b.1 Source_evidenceePCR684WS150 Sequence/Annotation Release
C41G7.5b.2 Source_evidenceePCR684WS150 Sequence/Annotation Release
C41G7.5a Source_evidenceePCR684WS150 Sequence/Annotation Release
C41G7.5b.3 Source_evidenceePCR684WS150 Sequence/Annotation Release
WB_DNA_textsjj_C41G7.51667acgggtcatctggtcttctggtatatcgtctagtcagcacaaaaactcgtcgtacgtattttgttcaaagctcctgtaggatgttttacaagaatagcaaaccggaatcaattggcttaactcacagattactcaagtaagttttttgatattagaaagaattgaaaattatacaaatatgctttgaatatctagcgcacatttgctgtaaagtgagaaaaagtgagaaaagttttcattgattcagtgagaaaatgttgaaaatcactcctatattgctaaaatggcaaaaattattttacaactaaaattaaaaactttttatcttaaataatcgatatcgcaaaaactcaatattaggctttctattctcaaaaaaaactgaaattttagtaaattcggaaaattcattaaaactttgactctttttagaaatccaaaacttttcggagcacctccttggaaaaatcgatttcatcgttttaagccatcatttatttttcagcgaagtggaaggtacaatgcttttagaaaaaagaagcacattgaaagctaaactattatcatttgacgattcatttcttcaatctccacgaaatctccaatcaacagctgcacttccattaccatctgtattgaaagatgatcaagattggtttgttactagcttttgacaaatttaacaataattattttcagtttggaaccatcaacatccaattccctattcccatccgttcctgttccaactcctacaacaaccaaagcaaatcgccgacgaaaagaaaacagtcatgaaattgttccaacaatcccatcaattccaattccaactcattttgatatgcaaatgtttgatccatcatggaatcatggagttcatccaccagcatggcctcatgatgtatatcatttgacacaatatcctccaacatatccacatccaccaggaactgttggataccctgatgttcaaattgcacctgtggattaccctggatggcatccaaatggtacgttacaattggaataacattgttgaaattacttatttttagatatacatatgacacagctgccacacggtttcacaccagatgctcaaaaggtattgtctgaattttagtctaaaaattaaaattaaatttcagcccatagcattatctgttagtaatggttatattttaatgtctttgtaatcatttctatctagtttatcttttatttttccatatctatcattatggttgtgtatatcaactaaaattatttatcagtaactcaaatctcggtaagtttttggaaaatgttttcaaaaataaaaatggcagagtggggaaatttttctaatatctgtctaaaagttgagtagcgtgaattgtaaatttgtttcaaaaaaaaatcaaaaaagtattcaactcggaaatacaacaaaagaaaaacggaaaatatagaaaaagatttaaaaatcctacttaaataatgcaattattcaattccgtcgttgtatttctgaagttaagtttttttttaaattttgaagcaaaattcccattcacgctactccacctttgaaaatgtattttgctctaattcgaaaatctacaaaaacgttaaactttcaaattttcagctcgtcccaccacatccacaaatgagccatttca