Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C42C1.10   

sjj_C42C1.10 RNAi JA:C42C1.10
Simmer:C42C1.10:Repeat_a
Simmer:C42C1.10:Screen
PCR_productsjj_C42C1.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C42C1.10 Source_evidenceePCR890WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV1228316412284811
Overlaps_transcript C42C1.10.1 Source_evidenceePCR890WS150 Sequence/Annotation Release
C42C1.10.2 Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_C42C1.101648tcgacgatggttggttatcatccggaggccataaatgagccgctaacctccgcggagtacagtgaagcaggtcttgcaagtggaattgtcactcggatgattattcaaccactagatgtactcaagattagatttcaactccaggaggagccgattcgtggaaagaaatctggaaaatataaggtaaaactattttttttgttgtcaattttaattcaaaaatattattttagggtgtaatgcaatcaatattcttgattacacgagaagaaggcgctcatgctttttggaaaggacacattccagctcaaggactatctgctacatacggacttgttcagttttcctcgttcgaatggctctcacagcaggccgcaaaagtgattccagcagataatcaaagtgttcggtctacatcggattttgcatgcggagcactcagtggatgtcttgcgatgactgcggtagggatttttattcagtttttttgttttcttatgatgggatcaaaattttgaaaaaaaaaacccataatgttctaaaatctgaaatttcgtcaacttttccttgtcgttgcagctggaatatatacaagcagaaaacaatactttttcacatttcaggcgatgccattggacgtgattcgtactcgactagtcgctcagaaagctggtcatgcagtttatactggaaccatgcacgctgtcaaacatatttgggaaaaagaaggaattgctggttatttccgtggatgggtacccagtgtagtacagatcgccccattcaccggaatgcaatttgctctttacaattgttttatggatctttggccattcaatggatacgagtctgcgggcgctcttttcagcggtgcgatggctggaactgtcgcaaaaacggtattattttgtttaaaaattttcaaaattttgatggtggttctcagaggaaaaaaaccaaattttttagtttattagcaaaattgaaaaagtttcatcttccataaaattttattaatttttgtaataaaaaattttcgaacagtttttttgccaaaactcaaccagttcatatttcaaagttaattttcgaaaaatcaaaaaaaaattctaaagtgaaaaatgctcgataatttgcaaaaacttcaaaaaagttggaggcaaccattttaatttatggttttgaaacaaaaattaaaaatcgagaaaaaaataacactttttttccgttttaaaaaatttatgtcatttttcgtcttttttgaagaaaattatgttttttgaaatcaagataattcacaaaattatatttttaaaaatccagtttcattgttaattttctaaaatatttattgaattttaaaaaaaaagttggattacacctttggctccaattgtaaaatttttttgttcaaaaaaaagtctgaattgaagttcgcttatattcaggttctatatcctctcgatatggttcgtcatcgtcttcaaatgaatggcttcgaacgagcgggtttcggaaaaacgagcaactacagtcaaggactattcaaaacgattggaatggttgtaaaaaatgaaagttggtatggattgttcaaaggattatggccaagtcaaataaaagcagctgccaattcaggatgtgcttt