Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C42D4.8   

sjj_C42D4.8 RNAi (2)
PCR_productsjj_C42D4.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC42D4.8 Source_evidenceePCR715WS150 Sequence/Annotation Release
Overlaps_Gene C42D4.8 Source_evidenceePCR715WS150 Sequence/Annotation Release
Chunk_score Abs_score600
Max_abs_score600C42D4.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV71647417165894
Overlaps_transcriptC42D4.8 Source_evidenceePCR715WS150 Sequence/Annotation Release
WB_DNA_textsjj_C42D4.81154ctccggatcgaaccattagaacaggaatgtcctgaaaaataattccagtccaaatttttaaaaaatcacaacataccccttccttgatattggagaaaagtttctgcacgaatagtggattaagcaatgtgaacttcatcttacgaacatgatcaccaacttcttggtttgaactgaacattgtagcgaatttaccaagttcgtctactgaaacaggactggcgaaggcaatcttcagaactgctccgacggctttttttacggttcctgaatacaaaaatatttttaatataacagaaattagaattaccatttttcaagccacaatgagaacaagtggaacctttcttgcatgctgcgacaatgcgtttatgaagtgcttttctgtgcagataatcaagatttggattcataacttgtcgagaaaagacacggtgttgttcaggagttagaagaatagatgaacagttctggaaaagttagaaaagttagcgtttaagacggaaaaacaattactttgcagatgcattgaagcaattgaatagttaacttgaaaaatccaatatggaacactggaacatcgagatcaaaatagccaaagtgaccaacacaatctgtcagtccgagaccgcatgtagagcaagttccagtttttgtggagactccctaagaaaataaactatttaaaatagacatgaaactgataatctaccattttcggatcgagtggtccatagtttgctggctgcaattttccttcaacatcttcgtacaatttattattgaaaatcggaacatgagccgtctgacgcataaactcacaatctccaggagcaaactttacgccgacactaaaaatttacattattattttaaattatgacattaaaactgaaaaagtaacaaaactcacactttcaaggccttgtcggcctcccgaaactgctctttacccattttgcatccaaacttcacgattcagatgataaccctgcaatttaatttttagtcggtatttatacaatatttaaagcatatttcaataattaaacgaagcaaacatcgagatttagcgaagaaattcatgaaaaattaatataaaaaaatttggaaaatgtttgcaacgacactccgctatcccgcttggctaaaca