Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C43E11.1   

sjj_C43E11.1 RNAi JA:C43E11.1
PF:GL1_3E10
PCR_productsjj_C43E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C43E11.1 Source_evidenceePCR772WS150 Sequence/Annotation Release
Chunk_score Abs_score625
Max_abs_score625C43E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42711474272216
Overlaps_transcript C43E11.1.2 Source_evidenceePCR772WS150 Sequence/Annotation Release
C43E11.1.1 Source_evidenceePCR772WS150 Sequence/Annotation Release
WB_DNA_textsjj_C43E11.11070ccaaggaagggaagaactccacggaaagagtattgacagtgacgttttgaaattcaatgattattctaatttcagaaagaaggatgtggaaccagaagcggagcctgagcctgaagcagatatcgccccagagccagagaaagtagctattgtggagaaaccagaaccgaaaccagaacctatcacggaaacagaagcatctccatcgttagtttaaaaatttcagtatctgaataatgttttattcgttcagaaaagcttccgagaaagatgccgcagttgaggtatctgttgaaaaagtggatgctgagacagctcaggaatccgattctccacaagaagcagagttagtacactactggtttttaaaaattaaactaagtttgatgttttcagaaaagaaaagaccgagccgcaagtggagctggagaatggtggtcaggaggaggacgagccaggttttttaaaaattaattattttatagaaaacctaattttgaaatttcagatcgcgatgaatcgatagagaagcaaccagagaaggaggatgatggggacgagctcgattatggagatgatgaagaaaaggagcagaaggacgacgaatcaatggatgcagaagatgcaaaggaagagaaggttgttcagatcgaaaaggaaaagaaagaagacaaggatgatggtgtcaagaaggaggaaaaggtgcgcgaggtgtctcgccgtcgcgtatcttctccttcgtctaggtaaattaaaattgccagtagaacatcggtctaaaatatgcattttcgctccaggcacccagtctcaaatgttgttcacattcgtggtttgacacgtccatttaccgaaggacaacttcgcgcagaaattcaaaagaactgcggtgaaatcgttgatttgtggatggataaggttaaaagccattgcttcgttaaggtataccattctatttcaaacgtttttttttcaattaaattgagtatttcagctaaattccgatgcggacgctgggaatgttatcagtgcaatgaacaacgtcgtttggccagatggtaacccaaaga