Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C43E11.11   

sjj_C43E11.11RNAiJA:C43E11.11
PCR_productsjj_C43E11.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC43E11.11 Source_evidenceePCR888WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.11 Source_evidenceePCR888WS150 Sequence/Annotation Release
Chunk_score Abs_score867
Max_abs_score867C43E11.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42500324250930
Overlaps_transcriptC43E11.11 Source_evidenceePCR888WS150 Sequence/Annotation Release
WB_DNA_textsjj_C43E11.11899caaattttcagggtagcagaatgtgactcatccgtagctgaatcattgaatcgaaaagtcgctggactccatgataccctcgacaaacagcttcgtaaaggagtcgaaactaatcttccacgactactggagcaagtgccagctcttcaatcacttgaagatactctacattcagttcaaatgcgaatgacatcagtgaccaaagaatcaaatcgactcgccacggtttgtgatgatcttaccacgaagcttcgcgaacaaactcgccaactcgaagcaacgatgctcaaaagaaacatggcttcagatgcccaaagatgtgaagaactttttgaatctcttgagaaacgaagtgatttggtgaagaaggcggagatcacatcggagattaaggagatactcaatgataataaaaatttgcgaaaaattggatggttgaagaatatggtggataccaagttgaaagtggctgaaaatgaagttcgacgcagtggagcggaggagttgaaacgaggtttagcgtcattgaatagctcgatggttgtatctgctcaaagagctcttcgaactttgaattatttggattcagaacttgaagttttgctgtcctcctctgttgtcgatctggataagaaattaatggaattatcaaacagctctccagaagttgctaataaaagtctccctgtagtcgctgcaacaattcaatcacatctcgaacaagcggctatgctgggtgaagtctataagaagaaattctctgaaaagttggctcgactgattcgtagcagagttccactcgatactccatacgctttgcggtttgtacagcaattgggtagagtattcaattcaaagggagatagttcacccgctttgaacgattctttacgtccact