Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C43E11.2   

sjj_C43E11.2RNAiJA:C43E11.2
PCR_productsjj_C43E11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C43E11.2a Source_evidenceePCR994WS150 Sequence/Annotation Release
C43E11.2b Source_evidenceePCR353WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.2 (3)
Overlaps_transcript C43E11.2b Source_evidenceePCR353WS150 Sequence/Annotation Release
C43E11.2a Source_evidenceePCR994WS150 Sequence/Annotation Release
WB_DNA_textsjj_C43E11.21676agtgcccattcgagattctgacaattgttgatttgaaaaatgtgcagggtattaataaataaaaaaatcgaattccagatttttaaaatctatatattgaattttcaggaatcggagagaatattgctctaaaattggaagaaacgtggaacgtcgcctgccgagagaacaatggccaggatccaactctacgaagcatcaaaaaattcacgacagacgattatcgccggttcttaacaaatcgaaaatcaacaacagaacggatgaaggatgcgaaaagattggaaaaacagaaatcaacgaaaaccattgttgatatagaaaatgaattcgaatcggatggagatgatgacaagcaaccaagtgttccactcactaaaacgaaaagctttcaagtttcgaagcccgtccagccgagcttgatacgatcacaaagtggaaatctttcgtcttcttcgtctacttcctcatcatcatctaattcatcagatccattatctttcagacttctcacttgtcgaccttttgagcagccaactgttagtatttaaatctaatttttgcagaaaaggattccagaatagaaaaaaatcggcaagtaatagaaaatccaatggaaaattaaaaaaaaaagatttttgaactccctccgaaatgagaactgtccgaccaatcagcgaatagctccgccccagcaatcagatggagtgggcggagttggaagacgcttattggttggctcgcgagattttgcggtttttgcatacggtacccgatctcgaagcgactaatattcaggagtactgtagctcccaactcctaataagttgcagaaacttctgccatttttcataagttttcgtccgttccttcgaaatttatcgaaaaagattttgaaacttgaacatttttgagctcgaaaaaaaaacatttaacaatattttttaaaaacgattaacaaaaatatgcaaaaatcgttgcagtgcaaaaagtgaaataccaacaaaaaaccaaattttcatcaaaaacccaatgttttggtgtcgaaaaaatggtcagctatttactccaccttcaaattaaaaaaaaacgaggtatttttccaggtctatctaatcgcagacaatcgtgagcatcgcaacaatccacgtttcaagtcggtaatcgagcatctcgtgaaaaaagaagatattcgagttgatattcgttctctttccgttggagattacatatggatttgtcgaaagattgatggaactgagattgtgatggattgggttgtagaacggaaaacttgggatgatctgcaatcaagtattcgtggaggtagatatgatgagcagaaaggacgattgaatatggctccgatgaagaatcgagtttatttgattgaagctcaacataaaggagatgttgcttgcgaacaggtagaatatagaattagaatctgatgatttttcaaaattctaacaaaaattccaggccgtagcatcaactctttccaatggaggatatcttattcaaagatgctctgatactcgagacacagctgcatttctcaaggaagtgacgattcgtttgcagaacaaagcggccatagaagaaatttcgggtgttccattcagccaactccagaatcttctccagaaaaagaaggcggaaactgtgaaagaagc