Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C43E11.4   

sjj_C43E11.4 RNAi JA:C43E11.4
Simmer:C43E11.4:Screen_A
Simmer:C43E11.4:Screen_B
PF:GL1_6A6
PCR_productsjj_C43E11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C43E11.11 Source_evidenceePCR16WS150 Sequence/Annotation Release
C43E11.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.11 Source_evidenceePCR22WS150 Sequence/Annotation Release
C43E11.4 Source_evidenceePCR843WS150 Sequence/Annotation Release
Chunk_score Abs_score801
Max_abs_score801C43E11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42484074249515
Overlaps_transcript C43E11.4 Source_evidenceePCR843WS150 Sequence/Annotation Release
C43E11.11 Source_evidenceePCR22WS150 Sequence/Annotation Release
WB_DNA_textsjj_C43E11.41109tccagttattcgaggttccgctttaagtgctctagaaggacaagatatttcgtgtatcgagagattgattgatgcattggattcacttccagagccggatagaaatgaaaaggatacttttgtaatgccaattgcatcgaaaactgctatcactgggcgaggtaattgaaaaaagaaatataaggtgtgccaatcaagaatttattttgcaagaaaaagtgcaagaaatttcaataaatgacattttttgccacccctaatatttaaaaaaaaaccaatttaaaatgtttttcaggaacagtcatcgtcggtacactggaaagaggtgtcttgaaaaaaggcgataaagttgaaatcaaaggagacgggcaaactcttcaaacgactgcttcggatatccaagtttttggcaaaagtgtgaaggaagttcgtgctggagatcattgtggagttctgtgtagaggagttaaaggggatacagtgaagagaggaatgtgggcaggacatccaggagcagtaacaattacgaatcgagtgaaagtggaactttatcttctctcggaggctgaaaatggcaggaagatcggaattcggactggtttcacagacaaaatgtactgcagtacttgggatcaagttggtcgtttcgatatgagcaatgagcttctgatgccaggagaacatacttctgctacagtactcttgatgaaagacatgccactcagaaaaggaatgccgtttacattgagagaaggaagcagtaaaacaacgatcgctagaggaatcatctcagatctagaggatcatgtggctgtagagaaacataatcttaaaaagtccgctgaaaagatgtagttctttatatattacagtattgatttattttaggttagattttattagcttgttaactactatatcttgttttgtttttgttttcttttgtcgaaatcttcgaataatatttcactacttttattgttcaaataataccattctcctattaatagcagttttacctgatctgctcattaatatctttatttttaattttcgtattaaataataatttattttttaattccagtttaaaatgtcggggagagtcg