Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C43E11.7   

sjj_C43E11.7RNAiJA:C43E11.7
PCR_productsjj_C43E11.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC43E11.7 Source_evidenceePCR691WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.7 Source_evidenceePCR691WS150 Sequence/Annotation Release
Chunk_score Abs_score607
Max_abs_score607C43E11.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42411734242798
Overlaps_transcriptC43E11.7 Source_evidenceePCR691WS150 Sequence/Annotation Release
WB_DNA_textsjj_C43E11.71626tcacgtgagagagtgtgagagaaaaagaggaattttgaaataaatgaaattgagagaggccgtgatggtgagaatattttttgctttaacttaccaatatacatataatctcctggaaagcaatttgtgatcaagttctctcctattgtcttgattggctgcggacaaattggctttttcacatttccatatttctcacaaagatcccaatctttcacctaaaaataaccatgtaattttcaggaaataaatctatgaaacctgtgaaaggcgggtaagttcatagacttgtggtggaggcaacgcatattttccggcataagcttcatcgacacactctttcggttcaatccaattatattccgacatttccgatgtacatagatcgattgctggttcgtctagaaatgtttttatattttcatgggcaactgttatattgtttttatgaaaaactttaaaatcagattttttttcaaatttgttgcattttgctcatttcctttgagttgtttgggcatttgaacccgttttccattattttcaaactcgtaccatccacgagcataagataaaactttgttagaaatcgtcgtggatagtttgctggagtgataaatgtatcccattcgataagattatctgcacaaatagttccggatagctgctcgaatttcgatgtatcatttacaatatccgctttcagactcgtcatatctggattattcgccgacgtttgccatccattctttgtcgaaagcactccagattcttcgaaaagctctcgaacagcagcaattctgaattcatcgccgagttttgcatcagttttgtcgacgactccaccgggaaaaaccatcgtatttggcatgaatttggcagtggtgccacgtttcagcatgagtacacggcgagtggttttgcatgctgaaattcaggttttttttattgagaaaaatgttaattttttaatagctgtgtgagaaaagaaactggaattgttttttttttgagcaaaaaaattaaattttttgacagcatgcaaaccgcaatcgtgtcatggggtacggtaggttacggtatgagatatcagaaccaaggctgggtcttttatggtatttttgcaccacaaaatccaaaaattgctttctgtactacgatcatttttcatattttacaaatattctttagcaaaatttggttttagtgatttttttccttaaaaaaattacaaataaatcgaaattcgacatttttggttttcatttttattttttttaatgtcatcaatttcgacataatcggtgaaaataattgaagccatttgaatttctgattttgccgccaatattataatacctaacgagccccaacgttaaaggacgaagcatttccatttagcggttgagcgcgattgcaccttgattctgcgtctccataataatattttataagttacgatatcatcgtttcacttttgaaaaatttaaagaaaaatacctaaaattatggaagcagccgatcgccaacttgaagtcacttttccgatacacatactgaaaaatgaccataaaaatataaaaatcacaagaaaatttaggaatttaagccaagaataaggctgtg