Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C44E4.5   

sjj_C44E4.5 RNAi JA:C44E4.5
[cgc5655]:C44E4.5
PCR_productsjj_C44E4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC44E4.5 Source_evidenceePCR997WS150 Sequence/Annotation Release
Overlaps_Gene C44E4.5 Source_evidenceePCR997WS150 Sequence/Annotation Release
Chunk_score Abs_score913
Max_abs_score913C44E4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46076254609885
Overlaps_transcriptC44E4.5 Source_evidenceePCR997WS150 Sequence/Annotation Release
WB_DNA_textsjj_C44E4.52261atcaacatgaagaatgtggctctggttaatgctctcacaggggatgccaagcaatttattgtgacatcgaatatcatggagatgggctacaaattgacacttgagaatttggaatggactttcaatcgaccaggattccaaatgagacttcatagtgaaatgctggagcgcatcaagttcgatgaaaatgattattctcaaatggaaactgccttgatcaagtattgttcaatcgcacgcgagatacaactatggtgtggacagctatttacactttttggatttcatcgacgcattaccggatgtgatcgggcgcaaagtaacgaagaagctcatggaggacgacggagcaacctttgattcgctgagcaaggtggctttcgagaagatctattgtctgaagtatcaggaaagtagaagagagatggagctcaatagataattttaaccttcattgttagtatacatagatgttcaagttttaccctttttattatatttaaaatctattctaaaattatattgtatttatatggtctaagtgatttatgaccgaatatcacatgtatccaataaatcgatgaatagaaaaaaatatgttgtgcttcttggctttctgaaaatgtgatctgaaaaacaatttggcttcttccatgagagctgggctccgcagtttgtttcctatatccataatttgctaacgcgcctgaatggagggttttccgcgaaatgcagcaatttttgcgctacaagtacggtatccggtatcgacacgacaatttttgttattgaggaaaggcatgtgcctttaaagagtactatattttcgaactttttaaaaaaatgtttcgataaaaaaaaatgttgttaatttttatttcaaacggtgaataacacaataagcacataaatttaaaattccacagcaatgagagattacagtactctttaaaggcgcacacccgtttctatctaacaaataattatcgtgtcgagaccgggtaccgtatttttggcgcgcaaatttcgcttttttccgaccaaaaaagcatttctggattgcaaaaaattaattttctgaattttcagtggaacattcatgggaacaaactgggaatattatccaagtggcattcaaattgaaatctgaaatttcaaaagaagacgttaaaatcgacacaaccaaaacaggaattcgtttgattgtcaaagatctgacccttctcagtggaaaacttagtggagaaattgatgaaaatgatgtggaaatttgtgcggatcaaaagacgaattcgtcagtttttttgatattaagagtgaaaaaataactcaaaatgagctatttagaaagacttcagatttcagatttttttaaaaattttcggccaaaaatttgataatgtgccaaagttttggtatatgaccaagcattttatcaagttttcaaaatttaaaaaaaattcaattttttttggaaattgatatttaaaaaattagtagcagaaaatttttttgccaaatttaagaaaattttttataaaaagaagtattctccaatttttggctgaagttttcaacatattcatattcatatactgccaaaattttgttaaattgccaaaatgagcacataaatttcaataaatacattacagattgaaactgaaactaaagtcaatcgatgataagaaatgggagaagctgatttctgtggaatatgatactctgaaatcattggaagattcagaaatcaagagaacaatgaaaggagaacaagtaattgaaagtgatgagccaatggaagaatgtgatgagactgaaggatctatggctttttattgggttgatcaggagtctggaaaagttttgaaacaggtatttgccaaccattttttaaagaaaattttgtgagaaactaatgattttctagaaaattttattcaagaatctaagaaatccaaaaaaataatttctagatatctttctttttgaatcaactgaatttcagtgcgatgtttctggaagtcaggttctttttacatcacgtcaatcctccacctctcctgctctcatttgtcttcgtcacgacgttgacggtcttctgtggtctttcgacgaatctgcacccagccacgtggcaactcttcaagcttttggatacgttcaagcttcgaagacaagccgtctctggtccggatgctcaccaaacaagtctttggcgtgtattgtagaaggaaataatcgagttctgctttactcgc