Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C45E1.1   

sjj_C45E1.1RNAiJA:C45E1.1
PCR_productsjj_C45E1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C45E1.1a Source_evidenceePCR890WS150 Sequence/Annotation Release
C45E1.1b Source_evidenceePCR890WS150 Sequence/Annotation Release
Overlaps_Gene C45E1.1 Source_evidenceePCR975WS150 Sequence/Annotation Release
Chunk_score Abs_score849
Max_abs_score849C45E1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI31074853109692
Overlaps_transcript C45E1.1b Source_evidenceePCR975WS150 Sequence/Annotation Release
C45E1.1a Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_C45E1.12208catgttgaacgatctgaaatcaaattcattgcagcgaaacgaaattcgtgtcgaaaatgccgattcgacgtgtgcctgcggaaaggaatgcgacgggatgcggtacaaacagaacgggatagaattcgaccagcaaatccgttaagcaacggaagtaatggaggaatagttccagatgatccccttcttgacacacttatcagagccgaggcatcgacaagaggattacggtaataatattgatgcatgactggggtctactgcggggaatacatttttttttagctgaaggggggtttcgcctgaacatacatattgaaaaatcactaccttatgaaggtcgaatgagcatcaatcattctaattttcaggacaacagtaatcacaaaaactgcagaagctcgtaaacaggcgaccacaaatgatgtaacagacagtatgaatcagcaattaacactaatggttgaatgggcaaaggttttggaaggatttcagagagttgataatatcacacaggttgccttgctcaggtatgcttattttctcaaatagttacaatttaagctggtatagcttcgcgtattcgtgagagcttgcgtcttgaaaggtgcttggtaaattaggttatgtatattttagtttatacatactcttatttaaggaaaaggcacatggcacaaaagcacaatttttttcaagtcaattgttttatttccaggcacttctcagcacaacatcttgtcatgtgtgcagcattccgaagcattcacttatcagatgcagtttggctgacaaatgagacatgcctgcacaaggatagtccaaagatcccggatatgaagttagttaacatcaaaaattgaaaattgaacacacagatatataaatgtacaaaacctttaaaaaattataaccaggagtggatttctaaaacaaaaaaaaaccgattattttggggcacttttttgaaaaaaaaaacgatgaacaacaaataaatgaattcttactgatacttccattttcagccgagtcgctgaacgaataatcgatcaagtgacgaatccaatgagatcgttacatatgaacgaaatcgagtatatcgctctgaaagctatcgccttttttgatccatgtaagtatacaaatccttgttgaattatttttcctacagaggattttttcagtggcaaaaggaatcacaagcgagtcgtacagtgatgtagaggaaatgcgacaacgggtgggtattatgaaagagatttttagaaaatgtcttttttttttaatttcggaaagaaggtctttgaaataatattgatcataagtttcatgtcagaattaaattatcctttttagtgtattaataaaatcatacgaatcaagggtgagccgcaaacgattttttctggcaaattgaaaaatcggcaaattgccagaattaaagtttccggcaaaccgacaaattgacggaattaaaaatttccggtaaatcggcaaacctgcaagttgccaatttgccgaatttgtcgacaaaaaatttgtcgaacctccgttgccgctcaacttgaacggcaatttaccgatttgccggaaaaacagtcactcacagacaaaatgcggaatttcaaaattccaaactcatcaaccaatttcaattttaactttcaactttcaaaaaaaattcaaaattcgaaaaaaaaaatcaatttcgaactcagttttcaaattcaaaatttctaaaccaaatacaactcgatctatagctgtactaaatgcattcttttttccagattctcgaatccttcgaacgacatgtccgatacgtgtccccttacaaagacatgcccctccgatttgcaaaccttctcctactccttcctccaatgcttgcgatttcccgtgatttggtagaagacgttcaactggcaaaactgttcggacttgcttcaattgacaatctgatgcttgaactgatgctaccaaatgagggaaaaaatacaactgacaagacatcacctccaattatgtgccatcaataaatttatttcacttatttatacagctgaaatgcaacagaaaaaaattgtgtgcactttttgaaacaaaaatagaatttgattttataaaaactaattaaaactttattcttgaaaaaatccgttaactaaacgtgtatatattgtgatggcattgtagtttctacctcgt