Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C45G3.1   

sjj_C45G3.1 RNAi JA:C45G3.1
Simmer:C45G3.1:Screen_A
Simmer:C45G3.1:Screen_B
PF:GL1_3E9
PCR_productsjj_C45G3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC45G3.1 Source_evidenceePCR1120WS150 Sequence/Annotation Release
Overlaps_Gene C45G3.1 Source_evidenceePCR1120WS150 Sequence/Annotation Release
Chunk_score Abs_score1078
Max_abs_score1078C45G3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI92237779224942
Overlaps_transcriptC45G3.1 Source_evidenceePCR1120WS150 Sequence/Annotation Release
WB_DNA_textsjj_C45G3.11166gcttcaagaactacgacgccgacatcttcagctttagggacatgcatctctttgccagtttcagagtcttgaagaaatatggcagattgggaagcggaaggaatagaagaaagagtttctaatgggatgtctgaaggtggactatccaagttctcagcggaaggagcaacagtgtctttgtcttggttttcatcatcttcatcttgttctctgaatacttccgcattgtgctccattctgacaacggttctctttttcaatgtacttggtacgaccgtttcgttattttccgaatcatcctcttcctcgataaccatcgcaattgtttttcttgtgaatgtacctctcagtggagttttctgcatcttgttcatgctttcaattgaatcacgtgaaacagtaaacgtcgcatcgttgaaggtagaatccattgattggcgagacgatgggatttgtgatagagatggtctttcagtcagaatattattccgtggagtcctcggtactgtgaaagtgacattattagagaatggagaaacacttcggtttcgaggaattgatgagtcggcaagaagttgttgtacaatgaaatacagcttgggagtattctgaaagtgaattataatataaataactttattttttgatgaatacctttctttgcacgtaggccttccacattcgttgaatcttggtcgctttctcatttagatcttgaatcatacccagtcgttccagaaacatttttacgaaaagagccatgttctgatcaagtcctcgctgaatacaaagctccaactcggcaactgaaacaactttctcccacagactgagtccatcatagtcctgaatcggtgttgaatttgttccgaaagtggtccacaacttggccagaaggcacccatcggagagtgaatccaagtccatgacttcgatttccatctgtcttccgtaaatcttgcacatttttaatacttcagaagacatgtcatcgtggacagcagatcgccgctttttcggagttctttcttcagaaactctcgtcaccttgattctttgttccttggccacacgaactccgataatagcccacaaaatagacaaaatctcgtctttctttccgccaacgattgattcggcgttaacattatccgttggaacaccca