Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C46H11.2   

sjj_C46H11.2 RNAi (5)
PCR_productsjj_C46H11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC46H11.2 Source_evidenceePCR881WS150 Sequence/Annotation Release
Overlaps_Gene C46H11.2 Source_evidenceePCR881WS150 Sequence/Annotation Release
Chunk_score Abs_score755
Max_abs_score755C46H11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI50506435052301
Overlaps_transcriptC46H11.2 Source_evidenceePCR881WS150 Sequence/Annotation Release
WB_DNA_textsjj_C46H11.21659taaccgacatctttgggtccgataatcaaggttgtgcatattcattgatttcaatgaaatatttgtgaattttctatagtatgcttttttgcagaacaaatcttccaaaagaagtaatgcaattccgtggagtaccattccgtaatgagcttccatcattccttacccacgaaaacgttcgagaatatcttcaagaattctctcaaggaatgccaattcatttcaatcaaacagtggagaatgttgaacgaattgatgacaaatggaaggtatgcaagattatataatttcatttcttgaaaatacaatgttataggtgaccacacatcatggagctggtattgatgaacactttttcgatatcgtatttgtatgtaatggacattattttgcaccaaacaatccttatgaagagtccgctttcgaaggtaatacttattttatagactaactgttgaaaatattttttaaaaatgtcaacttaaactacgtgcagatccctcgtgtccatgatagtattgcactcacccaatttttttttgcgacacatagtgcaataattgaaatttactttttgattaccgatttcctctagaggatttctttgaagcttacgagtttttttttctgaatagtcaattatttatttttaataactcatttaaaaaaaatcgctatcatgaacccgtgtagaatataattttaggatctttcatccacagtcatgattatcggcattccaaagactatatcgataaggaggttattgtgattggagctgggccttctggtattgatatttcacttcaactatctgaaactgccaagaaaatcaccctgatcagcaaaaaagccacgtatccaacacttcctgataatatcactcaaatcagtcaacacgtgaaacaagtagtacctgaagggtgtgaaactgatgatggaactcttattactgccgatgctatcattgtttgtaccggatatttttataaggtagttgattttatgcgtttgttcaaagtataggaaagtgataaacagttgttatttttcttaattaataactttggaaatagtaactcaccagacaacctaaatttatttttacagtacccattcctcagtgacaatatacttcgggtaaaagaaaacaatcaactggtatcaccaatattcgaacatgttgttcatgcagaatacccgaatagtttatattttattggtgagaaaagttcagacaatcagtttaaaaattttataattttcaggtctcaatcttgtcacaattacgtttccactatttgaatatcaagtaaagatggcactgtcatttgcaacgggtcgagcgccaatcccagatcggaaaatgttgattgattacgagaaaaatcaaattgagtaagtcttttataaaattgttaggcttttatcatccaatccggatatactataatatatagtacgggcgaaaaattgataatatttcgatataaaagtttctgaaagtgcgacagaaagttgacaagaggaccacacttgtctcgcagggtaattttcaaacaataagttgtgtaatgcaactttaaactttcagacatcaaaagtctcgtggcctcgctgttcggttctatcatcttctgcaatcagagcaatgggaat