Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C46H11.8   

sjj_C46H11.8RNAiJA:C46H11.8
PCR_productsjj_C46H11.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC46H11.8 Source_evidenceePCR644WS150 Sequence/Annotation Release
Overlaps_Gene C46H11.8 Source_evidenceePCR644WS150 Sequence/Annotation Release
Chunk_score Abs_score560
Max_abs_score560C46H11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI50446205045738
Overlaps_transcriptC46H11.8 Source_evidenceePCR644WS150 Sequence/Annotation Release
WB_DNA_textsjj_C46H11.81119actgagttgttgcaaagagaagcacgagctgggcaatcggaaactccagttgttggattgacacgatcagcacaggtggctgaaatttcctcagttagtgcaaacgaaaatataagaaaagctaaggcaaacaaagcaagcatattagacagaagcaggtaaaaaaagctacagctgatcagcgaagcaagaggcaactgccacctactggaatagctagaagtactatttgtggagcatcttccacaagttaccggacactggactgtcataagattgtaataagctgcgttattacaaagtgcggcacgagccggacaatcagatctcccggtggatgggttagaacgatcggcacatgtggtgcctggaaatttaaattgttgtcctctgtttcaagaaatctaactctaattaaagaatcacgttccagttttcagcgaacttactggacgatgaagtagtcgaagaagaagtggagcatcttccgcaagttcttgggcattgagtggtcatgagtgtgtagtagttggagtcgttgcacaaagcagcacgagctggacaatcggaaactccggtggatggattaacacgatcaacacagctagtagagcttgttgaagtagaattacagcgaccgcatgttcttgggcactgctgggtcatgactgtgtagtaggtcgagtcgttgcaaaggtaggcaagagctgaacaatcagagactccggtagatggattgacacgatcagcacacgttgtcgtggaggtagaagttactgtaactgatgatgcagttgtggttactgtagatccatcggaatcggtcacaacagcagcagtggttgaagtaacagcggcagcagctagaatttcaaaggtcgctgttgaaagaatctgtttcacttactggtaataggacagcattgaccagctgccacgtcacagacctgtgtctggcacacaagaatgccaccgtcacacgctgaaataaagtatttattctaaatgcgattacagttgttacttacgtccttcagattcagaagcttcacaagcaaatgcaaccgagaatatggcaaatgaaataatgaattgacggaacatgatagaatgatggtt