Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C46H11.9   

sjj_C46H11.9RNAiJA:C46H11.9
PCR_productsjj_C46H11.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC46H11.9 Source_evidenceePCR697WS150 Sequence/Annotation Release
Overlaps_Gene C46H11.9 Source_evidenceePCR711WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627C46H11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI50463785047940
Overlaps_transcriptC46H11.9 Source_evidenceePCR711WS150 Sequence/Annotation Release
WB_DNA_textsjj_C46H11.91563ctatttgaacacatttcttcccgactcgcagcgttttattataaattaaaatgaattggacacattattacacaattattactaatcgtgatggcgaaacaaattatccggatgtacagaatccgcaggttcttggacattgagcacgcatgacggattggtaggctgagttgttgcaaagaccaatgttggatgcacaatcagatcttccggtggctgggttgactctgtcgacacatgctggaagattttcaagattggttttagaaagtaacgaatgcttgtgttattgttgaaaatctatggccgtacattttttagataatacagtagattgttttaccttagaatcggatgtttcagatttttttggacagttgttttctctttttttaaataaacaagtagttagtttcgtctaaagttggggaaaggttggctggtagttttgagtcattaaaaactcggactttttatttgtgatatttggccatgttgcaattaatatgaaaatatttgtacaactaaattttgcttaaatttaatactaaatcaagctccaaccgttaaaatcagttttaacacttttataatttttcccacttacttccggaagaaacagttgcgctggatctagtggtagaagatgaaccggaacttccacagaatccacaagttcttgggcattgagttctcatcagatcaatgtagttggaatcattacagaaagaacgcaggcttgcgcagtccgaagttcccgtctttgggttcttcaagtcagtgcatgtaccagttgtaggtgtgctagagaatgatgagcatcttccgcaagtctttggacattgttgagtcatgacgtcaaagtagttggcatcgttgcagagagctcttctattagcacaatcagaagttcctgtagctgaattgacacgatcaacgcatcctgttccagatgaagtgcgggaagtgacagtggatccactacggatagtcgtggcaacagtcacagtggatcccgaagcgtcggtgacaacgttagatggaaccacagtggtgactgaaaagggaaatttaaaatttactgattccagagacttactgagatccgcattgagacagcaacttaaaagagtaagatcacaagtagatccagtttcacaaggcaaaccaacatcgcatgctgaaaaaatgtttggattaaagaatcgaatttgagcgcgaaaaaagtgttactcgaccaatgacattaaggcgtggtcaacgtcattgattggtcaaaagtttcaaaaatctaaaaatctaaaattgcgcccttctgctggctttaatttgagagtaaatttcccagaaaaacttttggaagtgttcaaatttgaagcctgtgcgatagtttctttgtgaagggtcttgaagcgagagatgtctcaacgaataatctcaaagtggaaagccagtatgctaattaagtcccaattactgtattgctcgtattactgtaggggcaaatgattattaattttcaagtaaaacatacgtgcagtaattctgtctgggctacacgtt