Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47B2.4   

sjj_C47B2.4 RNAi JA:C47B2.4
Simmer:C47B2.4:Screen_A
Simmer:C47B2.4:Screen_B
PCR_productsjj_C47B2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47B2.4 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene C47B2.4 Source_evidenceePCR765WS150 Sequence/Annotation Release
Chunk_score Abs_score723
Max_abs_score723C47B2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1296744612968568
Overlaps_transcriptC47B2.4 Source_evidenceePCR765WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47B2.41123ggcctggaatttgtagacgaggtcgttgggctctggtcgcttgcagaattctggcacaattggccccttgaagacggtctcgcttggctcgatgatcacaagattcaaactgtttcctgaggcgttgtcaccgtgcataccggcttccagggcgcgttggacaagcttctcggcttcatctttctgaaaaatataattatagtatttttagcgcattggaattcaaaaatagactacttaccgtcatatcaaccttaaaatcacgctccaaaatagtgatagctgcatatgatccagatccttgagctgtgaatgggaaggccattgtagttccgttggcggagcacatataaagatgtgggccagttggatcgactcctccaatgagcaagtaggctccgatgtatccttgatagttgaaaagatgctgcttagcttgacgaagagcggtgatcacacgagccttgcgcccggtgtttaattccagaagacggagatttccagagagcatctttgtgacttgatcgagatcggcggcggttccggctccgcaggcatagatcgactcagtgagcttgtgaaccttctcgcaatgcttatcggcgatgatatttccggcggtggcacgggaatcagctcccatcacaagtccgcccttgaaggcaacggcgacgatggtggttccggtactggtgagctttggagcctttccgcccatcttgcacattgcctgattacgaatgcagttggagaagtcgaacgcgcctccacggtccatgtccatgtgtgggacggtggatttgacgtcagcggtggccattctggaattaatgttgtatttgaaaagatctcacaaaacattttgagaaaaaaaaacaataaaaatgacaggaaaaatacggaaaaccatctagaaaaaactgattaacgaaaaacttcgatttccctgatttctgctgtctcacaagtgattttctgcagataacctattcaatagcgaacttccacttaatttctacaaatttttaatcaaaaatacgctagaaaagcaggaaaaatggtggaaaacttcgaaaaatgttggaatgctgacaaaaagatttttcaaagtcatcgcaacgac