Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47B2.5   

sjj_C47B2.5 RNAi JA:C47B2.5
Simmer:C47B2.5:Screen_A
Simmer:C47B2.5:Screen_B
PCR_productsjj_C47B2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47B2.5 Source_evidenceePCR770WS150 Sequence/Annotation Release
Chunk_score Abs_score707
Max_abs_score707C47B2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1296896512970056
Overlaps_transcript C47B2.5.2 Source_evidenceePCR770WS150 Sequence/Annotation Release
C47B2.5.1 Source_evidenceePCR770WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47B2.51092acgaaggatcgaacgatgtcggtgtgttctgcaccctcaccaacagctactgcctcgtcggcgtcggtggcactcagaacttttacagtattttggaggccgagctcagcgatctcatcccagtcgtgcacacgtcgatcgcctcgaccagaattgtcggaagacttacagtcggaaatcgtcacggacttctcgtaccaaacgccacgactgatcaggagcttcaacacttgagaaactcgcttccagatgaggtatgcgggcaggaaattgagaataaatatttaaaatttgaattttcaggtcgcaattcgcagagttgacgagcgtctttccgctttgggaaatgttatcgcttgtaacgaccacgtcgctattgttcacgcagaaattagcgcagaaactgagcaggtaaggagaaatcctacagaactgcgactttcagtgtgatattcccacttttttaatcgaaagttagtaaagaatcgtcgaaaaatgttcgattgttctgaaaatgatatttattttttgttcaaaagttcgaaaaagacccaaactttagtcggaaacggacaattttcataactttcttattaatttttgattcaaatgcttggcttaacatactgaaattaacaatgttcacactacaaactacaaaaattcctaaattttctctttcaggcgctcgtcgaagtgctcaaagtggaagtattccgtgtcagtctcgcccaaaactcgctcgtcggcagctactgcattctcagctctaacggttgcctcgtggccgcccgtactccaccagagacccaacgagaaatcgccgctctccttcaaatcccagtcgtcgccggaacatgcaaccgaggatccgagctcatcggagccggtatggtcgtcaacgattgggtcgcattttgtggactcgactccacttctaccgaactgtccgtcgtcgaatcgatcttcaagctcggcgagcaaggagctccgacaagcatcagcaatcagctcagagatactctgattgagagcatgctctaatcttttttctcactatttttttgatctaccattcattgttttcccacc