Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47B2.7   

sjj_C47B2.7RNAiJA:C47B2.7
PCR_productsjj_C47B2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C47B2.7a Source_evidenceePCR817WS150 Sequence/Annotation Release
C47B2.7b Source_evidenceePCR817WS150 Sequence/Annotation Release
C47B2.9 Source_evidenceePCR8WS150 Sequence/Annotation Release
Overlaps_Gene C47B2.7 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score773
Max_abs_score773C47B2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1298132812983018
C47B2.9 Source_evidenceePCR8WS150 Sequence/Annotation Release
Overlaps_transcript C47B2.7a Source_evidenceePCR836WS150 Sequence/Annotation Release
C47B2.9 Source_evidenceePCR8WS150 Sequence/Annotation Release
C47B2.7b Source_evidenceePCR817WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47B2.71691caatatttagcgcgaaaccaatatttggaatttttttttgttgggaaaattttattgtctaaaatacctacaagacatgtctatgtctatagtttgtagccttctccaaagtccctgtcaaactacaaactacaaactacaaactacatcttccagactaaacaccgaaatcgaatttcccgcgctcaacgagaaacgtcgtgtcaagaccctcgaaacatggaaacaacgtgttggccaagtggcggcgggcgcccgagccgccttccttgtcgccccctcatttgatgaacatcgtttctcccgttgcatctgcggaccgctcggaaccctaaaatccacgaaattcgtgctggcaaccgtggaacctatccagttttttagaaaatcaataaattccaaatcgaaaatccacgtggcagtcgcttttgagaccgttatggcggaatgtcaatttctcaaagaaaaggaaaatggagaatttgaaatggtaaaaatattgattttttccaatttttaccaaggaaaacatacaatttccagcttccaagtctcctggcaccgtgccaagtgctattttcattcgaaaaatcgatatttctacccgaaaactacagtaacccgttcatggccgcccgtctcgaacaacaaccgggcagtggatgccgtttcgctttttccggaattttcagccaaattttgcctgaaaatgggaaaaatttgccgccgagatttacgagaaaatgcagaaaaggacatgtggaaagagtggaaaaagatggattttcggcgatttgtactggaatgttcaaggccgaaacgaattttgacgtttttcgcggttttcaggtggtgtagaaaaacgtatgtagtttgtagtttgacccatttaatttttttcagatctgcacctcatctggtccacgtggaaaaatcgaaggcgctttcggaaaatcgggcaaatttcgtgtaaccttcgccgaaaaaatcgacggaattctgacggagaaggaggaaatttcactttttttgaagaaatatcataatgagaatagacttgtcagttatgtacctgattaattttaaaaaaataaaaatttgaatattttatacttgaatatttttttggatttttgactgaaaatcaaggtttggagcctttttaatattttaatttggcatttttcagatttccagagaagtcggctttttagcttccaattttctaaaaattgtcaaattatctttcaaaaatctatgaattttccaaccacaaaaagaataaatttttgtcattaaatttacactatttgatctctaaaaaatcaccaaaatttcaaaaaaaaaatcgttaaattttccacaaaatcctaaatttcctttaaaaaaattgaatttttcaaaaatattttcaatttttcccaaaaatttgttaaaattccctctaaaattcattttttcttaattttttcaaaaaaagccaacaaatttccagaaataatccttaaattttccaaaaaaacgttttatttcttgaattctcccaacgtggccgtgtaagaaaaaactcggccaccaatgttcaaattttttccgcggccacattacaaattccgcttggaaacacacatttcccttcactttcagcattttttttttcagaaatttcaaattccaggattaatgctcac