Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47D12.7   

sjj_C47D12.7 RNAi (5)
PCR_productsjj_C47D12.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47D12.7 Source_evidenceePCR764WS150 Sequence/Annotation Release
Overlaps_Gene C47D12.6 Source_evidenceePCR40WS150 Sequence/Annotation Release
C47D12.7 Source_evidenceePCR764WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619C47D12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1169025111691273
Overlaps_transcript (5)
WB_DNA_textsjj_C47D12.71023tgcaagcagtcttgaattgggtggctcatgaagagcccagtcgacggccttttttggcagagtgcgtagattttactacaaaaatatggtctcgacacgacagtttttgttgaaaagaaatcggtgtgcgcttttggagagtactgtagttttaaactttgacgaaaaactatgaaagttcgaaactacagtaccccttaaaagcgcagactttttcgcatttgacaaaaatttgtcgtggcgagaccttgaaacaaaaatcaaatgaataaaaactttcagactaatgtcaaatgttcgcctgccattgctgggtgatgattatcttttcgaaaaatggagaaatgacgagatgatcaaaagtgatgcggcttgtctaaacgtgatcatcgaaggaatgcatcagctgaaaatcacgaagcaagacatttccagcacggagccccactatccgattcaggagctcaaccgaaaatggttcgtcgcccgtgaacccatgccagaatcccagcacataatgatcgtcggtgggcaggctccaaaagcgatcaccaacgtcgatttgttcgatcctgatagccaactctggagctcgtgtgcatcccttccacagagaaggtgccgaagtggagtgagcatgtgcaatggttacgtgtacaccactggcgggttcaatggagcacagcgggtgagatccgtggatttctatgatccacgaaccgatacatggcgttccgcgaatcagatgagtgctcgccgatccactcacgggataaccacgtgtcaacaggtgttgtatgcagttgggggattcgatggaactaccgggcttgcgagtgcagaatatttcgatccacacacaggaaattggtttccacttccatcaatgagcacgagaagatcaagtgttggagtggcagcgttcgaagaggatatctatgcgattgggggattcgatggtgtctcaaagcaatgcctgaatacggtttgttttacttcatgagaaacactggtgggaaatgg