Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47E12.1   

sjj_C47E12.1 RNAi JA:C47E12.1
Simmer:C47E12.1
PCR_productsjj_C47E12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47E12.1 Source_evidenceePCR861WS150 Sequence/Annotation Release
Chunk_score Abs_score819
Max_abs_score819C47E12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1000386210004763
Overlaps_transcript C47E12.1.3 Source_evidenceePCR861WS150 Sequence/Annotation Release
C47E12.1.2 Source_evidenceePCR861WS150 Sequence/Annotation Release
C47E12.1.1 Source_evidenceePCR861WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47E12.1902tcaaggatccgaagttggtcgacgaagtgattgaattggatgagaaatggagaaaggagagatttgtggctgatcaacttaatcgccagaagaatgctatttctaaagctattggggagaaaatgaaggtcagttaactctaacttgtgtcaaccaaagatttttttagaagaaggaaccacaaggaacagacgattccgttgctgatgacattgtcgcacgtcttgctgaattgaaaattgatgagctgtctcagttaaccgttgttcaactgaaaaagctcagagtccttgtcgatgagaagtctgttcaaactgcagctgccgtcatcgccaacgaaaatgcacgccatgagaagctcattcaaatcggaaacttgattcactctagtgtcgtcgtatcaaaagatgaagctaacaacaaaattgagagaactttcggagatttaagcaccaagaagaagtattcacacgttgatttggttgtgatggttgatggctttgatggagagcgcggaacagttgttgctggaggtcgtggatatttcttgaagggcccacttgtcttcttggagcaagctattattcagttagctctgcaacgtctcaatgtcaagggatacgttccactatatactccatttttcatgaggaaagaggtcatgcaagaagttgctcaactaagtcaattcgatgatgaactctacaaggtcagctcgaagggatcggaaatcgcaggtgatacatctgtcgacgagaagtatttgattgcaacttctgaacagccaattgccgcctatcatcgaaatgagtggatcaaagagactgagcttccaatcaaatatgctggtgtctccacttgcttccgacaagaagtcggaagtcacggtagagatacacgcg