Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C47E12.1_b   

sjj_C47E12.1_bSequenceCGCGTGTATCTCTACCGTGA
In_sequenceC47E12
PCR_product sjj_C47E12.1
smd_C47E12.1