Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C47E12.6_f   

sjj_C47E12.6_fSequenceACAGTAGGACCACGTGGAGG
In_sequenceC47E12
PCR_product sjj_C47E12.6
smd_C47E12.6