Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47F8.2   

sjj_C47F8.2RNAiJA:C47F8.2
PCR_productsjj_C47F8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47F8.2 Source_evidenceePCR845WS150 Sequence/Annotation Release
Overlaps_Gene C47F8.2 Source_evidenceePCR845WS150 Sequence/Annotation Release
Chunk_score Abs_score740
Max_abs_score740C47F8.2
Specificity_index0.803
Rel_score1
Map_statusUnique_ePCRI1233203812333613
T12C9.3 Chunk_score Abs_score182
Specificity_index0.197
Rel_score0.246
Overlaps_transcriptC47F8.2 Source_evidenceePCR845WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47F8.21576accggaaacacttcaaaacggtgaaaattcggctgagcgccgacccgaacggcggcctagcagttcacagttcacattttcaactggttttaactatcttaatttgcgcgcaaaattagaattgagctttaaatgtgattccccgcactaaaggttttcatcaagttattttctcatcatacttttgcatggaaaaacatagttcactttacagttgttcaacagagaagaagcaccaacgccaccccaaaatatatactaaactccacatctggcagtagtaatagagaagttgtcagaggtttgtcgagcacctctagaactatatcaactactttttttacaggttttatcactgattcgaattctcatctggtcacccaaactgaccatttaagaaatatcgacaacaatgagcactgtaaagatatgaaaaagtacagcgatttgctggaaattagtcatatgaacttgttgaggttctatgtgaagcaagtggagccggagaagaaggaacttaaggtgagcactttgagcaaccttctagcagtcctcttatttcagaatattcttcaaataaaatcaataaacgatctaatgatcacttgtgcatacgacaatggctctgcgatggagtcttgtgtccactgccctggaaccggtaaattgagccaggaagatgtacggctcttgcagaaatcctttcaatttgcacatacttggctggattctacgtggcagtactcaatagcaactgacattgatgagagtgaagtttctggagaaagcgagtaagtaattacttttaaaaaaatgtgcaaaaatgcgccaaaatgtgcataaaatgtgcaaaaaatgtgcaaaaaatatgtgcgaaaatgtgcaaaaaatgtgcgaaaatgtgcaaaaaatgtgcaaaaatgtgcaaaaaatgtgcgaaaacttttttttcaactttttttttagaaatctcagtcaattcatatcccatatcaagtcaactcttggagcttgcctagcaaatttgaagctggatgtctacgagtttgcagcctttaagtcattttgcgtctggagcattggagctcagggggcaacggaatcaatgaaagttgttgctcaagagcactatgaagcagtagcttctgcgttgaaaatgtattacaaggtgaggaagctttaatgaataatatgtaggcgaccttctttagaccttcacctcaatgagtgatagtgaaatcgcaacgcgaatagaggaaatttcgtttggaaggtcgtcagatgtgcagatgatctacgatgagactataaagctgtacaacaaaattggcattccaaaatctttattttttgaaggaaactagaatagttatggaaaattgtcaataaattattgttgaatttatttaaaaattaaaaacatattaattcttgttgggcagggttgaaagtgttttcaaattatgtcaaaaatagtccaatttggactgaaaaacggactaaaccgagcttaatactgtttctgtctaatctgaggcattgtgctgaagtaagcatctcccttgcgtttcagact