Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47F8.5   

sjj_C47F8.5RNAiJA:C47F8.5
PCR_productsjj_C47F8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47F8.5 Source_evidenceePCR989WS150 Sequence/Annotation Release
Overlaps_Gene C47F8.5 Source_evidenceePCR989WS150 Sequence/Annotation Release
Chunk_score Abs_score863
Max_abs_score863C47F8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1232210612324142
Overlaps_transcriptC47F8.5 Source_evidenceePCR989WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47F8.52037atcatgcaaattcaaaaggaaaatttgttttcgaagaaaattgcacgaggagcgggtggaatttaagcaagcttcattgattattttttcaaaattgaaactaaaatttgcagatacaactgcggagcggaccatggactacggcaccagcttcatcatatccttcgcagacattcaaaaaacctacaaatggctctacctacctgaaaccgacatcgtcttgcggagccctgacattctcatgatggtcgcctcgaggactgatagttttgccaggaggaatgttttgaggaagacttggatgaataagaattatagtgaaattgtgagggatggacggatgaaggcgctatttttggttggtatggtgtcggaggactatcgagtcaggaggattgtgatggaagaggcaaagttgtatggggatatggtggtcattgatttggaggatacttatgatgatttgccgtttaaggtaaggcacgtggtgccaggatgtcccatcacggtttgatctacaaaaaatgcgggaatttatggctcaaaaaatgtgatgtcagcacgttcttaatcatacaaaatcaattgaaaactctgtgtctcttctcgcgcattttttgtagatcaacgtagatcaagccggaatgacaccctcttgcaccacgtgataagggttaagaaaaggcctttttgaaaaattcattgccgaaattgtttcagttttttttaaataaaaatcagtgatctaatcttgttttcatattttttgcaatcatggaaacaatatgggaagttttcaaaaaaaaaatcagaaattttttaatgcaaaatttttttaaaacattttttccggaatttcggcaaacatttgacagggttttataatttgttttgaaatgtggaaaagatcaatataactacaattaatcatttcccaagtttcagaaactttttgttctgagaatttttgaaagcttgctcaaaaaaacttgctcacaaaaatcagattttttcaaaaaattatttttaatgccccaaatatatggaaattacagttcccaagttgtgtcataacagtttttcccttttcaaaatcagtagacaaaaaaaatataaaaaatagagaattagagctacatacacttgattctccgccatgacgtatctctacccaaaatcagtttttcggagatttttcggaagccgataccttacctgataaattttcagtccctctccctgctgctctacgcagtgagcaaggctccagagttcaaagttattgggaaaatcgatgaagatgtcatgttcttccccgacaagctaatcccattgctcgatggaaaagttatcgatccggatgccgcggccttctacgggcagctcctgaaagagggggaacccgttattaagaaaaaggatgctcactggtaacaattatatttttctattatagaaaaaaactaggccaacaaattttctaggtacgtacccgattacgcgtacaactgcacaggatacccagcatacgtcgccggcccattctacctggctactaggaaagccgccaagctggtgctgaaattcacaaagtttcagaattttatgacggtactgtctagcgtaaagttcaataactcctattgaaaatttcaggttgaggactcccttatcaccggaattctagccaatgacctagggataccgaggaaaaatttggagcatgtgtacaggcatgattatgatgtaagtgatagttttaatgaaacattacccagaaaaaataattcaatttattcagatccaagataacgaggggaaggagattttggcgtggcattcctttaaaaataatattccatatcgaaatttttttgtgaagcgagttgcaaggcatcgctacgagcagaatttgtccaatatgcttttggagattaatcgctaaataaagttttttttgtaaaatgagcatttttgaataaaaaatttcagtagaatttgacgtcggagatagctcatggtcacgatttctagtcc