Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47F8.7   

sjj_C47F8.7RNAiJA:C47F8.7
PCR_productsjj_C47F8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47F8.7 Source_evidenceePCR468WS150 Sequence/Annotation Release
Overlaps_Gene C47F8.7 Source_evidenceePCR468WS150 Sequence/Annotation Release
Chunk_score Abs_score405
Max_abs_score405C47F8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1232613212327297
Overlaps_transcriptC47F8.7 Source_evidenceePCR468WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47F8.71166ttcagaaaatcgaaaatggagaatattgcagagatattaatcaattgaggccaataccgcgcgtaattttgtacgcacttccctcacacattgaattgtacggacatgcgatagtccttaagattaggctgcaggttcgggaagaggtacagaacgggggtcttacaggacttgcggccccgagaaaaatgggaaaatcttgagtttttataattttttaatcaaaatagaaacaaaaaaacaaacaagacaatttaaaaaatcatttttatgcaacatgactgttcatcatcaatatttctacttttacagcatttcgtcattcaggaaaatttcggaaaagtggaaacggatagttttgcaaatgacgacaagctgaaagacagttcttcttgagtgcttgggaatctcggcaatttcgatgaattccccataaccctcacgcagggcttgtttgacgagacgcgtaatatttttttcagacgtgtgctcaggaagaactgaagtgacggcacttgtagcaacctctgaatttaatatttgaagattttaaccaagtactcgacatactttccggaagattattcatatcgtcatcgctgaatggagtttccgattcgtaataagattttatagtaaacgtttcgtagattggtgcgtcgcctgaaagaatacaatgaactgacatactgttaccttctgaatgttctaacttttgttggaaactgcgagaataactttgttcgaagctttgcatttcagatagtcgtcagcggttttattaacaaatccaggacaacggggttgacattggacgtgccaaactgcaattgaaatgagcaaaaaaagtgtagctggagggagcattggttggacggtgctgaaacagagcagtgttctgcttcttgatataatgattgtattatagatttattgctactatatatgccatcaacctacgtgaatacgtgtattttttaatcggagctaatttttcagaaaaaaacgcataaaacctaaatttttatagattctcaacaacaatcaatcggcgaaaaacgaagggagaaaagttatagaatctgccaatgtgggagattgtcatatttgatacaatagctcctttttcctctgtcttcgttatcagtacctctcgggatacatgt