Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47F8.8   

sjj_C47F8.8RNAiJA:C47F8.8
PCR_productsjj_C47F8.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47F8.8 Source_evidenceePCR846WS150 Sequence/Annotation Release
Overlaps_Gene C47F8.8 Source_evidenceePCR846WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714C47F8.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1232825912329407
Overlaps_transcriptC47F8.8 Source_evidenceePCR846WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47F8.81149gcagttctggaaaattgggaaattacaacttttcttatagttaacacaatttttgatgcttgataccaacctcataataattcctcagagcgccagtgacaccttcataatgctcatgagcaatgattttctgagcaaaagacgtctcgtagaatctgagcttccagatacacaatgccttgaaagctgcgaactcgtagatgttcaggttgagatgagccagagaggatcccagagttgatttgacttcttggatgaagcgggatagtcggctgaaacctctaactgtttcaaaatacataattcagaaacagaaacttactcatcagtatcagtgtggctatcaccttttgcgctttccaaaacggaatcgatgagcaccgagtcaacccagatgtttgagaacctgtagtatctcagcagagcctccacatcttccttctcaagcatgtcaactccagggcatcgcaggcattcctccattgatgggccactttgacgagcggtgattaacatcaggtcgctgatggtctttatttgaagggtgttctgaaaataaactcttttttttaattccaaaggttcatagttttttactttttcacagcctctccgcttctcggccatcattttctttacttccttcacataatactgcagtaaatcatcatggtacatctttaagattttgctatactctggatcatcagattcctcgtcggtttttgaagatgatgactggccaccttcagaggtggcaggtgacatactatctgaaaatgcagaattttttgaagagctccaaattgaaatagaaacgcacctctgaccaggttttgctgattgctagccgcgtcgggaaaacgcagatagatgttgttcttttgcttccgaattactgaaatattaagttttattctggaatttgaatctttaagaactcacgctccagcttcatcccggccttcaagcagctcgcatatctgcatgctctgcagaagaacttcctatctaaaattgcatcataaattggaattttaaaaagtcttacttaccaaaagaaatagtgcatctattctctgcagtacataaatactgcattccaatggatcttcggaagaatgcagcgcaagccgtgcaggaaataat