Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C48B6.2   

sjj_C48B6.2 RNAi JA:C48B6.2
Simmer:C48B6.2:Screen_A
Simmer:C48B6.2:Screen_B
PCR_productsjj_C48B6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C48B6.2 Source_evidenceePCR615WS150 Sequence/Annotation Release
Chunk_score Abs_score531
Max_abs_score531C48B6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69165586917528
Overlaps_transcript C48B6.2.2 Source_evidenceePCR578WS150 Sequence/Annotation Release
C48B6.2.1 Source_evidenceePCR615WS150 Sequence/Annotation Release
WB_DNA_textsjj_C48B6.2971tcctcccaattgtaatgaagctatgaaatttctgatttttatattttttgcaatcaggtttaaatggttcacaagccgaatacttgttaaattcacccaaacggaaataattttattgaattcttgtctttataattctacatttagtcaaataagcgtcttcaaagtttagtttttttcttatttgttagaatatatgactttcagacaaaaaaccccgacaaaatggtgcgaaaactgaaaacccatgagcaaaagctgcttaaaaagactgactttatgtcatggcaagtcgatcagcaaggaaaacaaggagatatgctcagaaagttggtgtaaatgataatagctctggagttttatatttattttttagattctatgtgaaaaaaagagagcactacgctttgtacaacactttggctgcaaaggttacagttcaaaaatcggataaaaataaatatttctaatcttgaaaattttccagagtcgtgaagtagctgatcttatcaaaaacctatcagaatcggatcccttccgatcaaaatgcacagaggatatgctcaccaaattttacgcagctggacttgtgcccactagtgatacgttggaaagaattggaaaggtttttgtcctgtttcgattttaattacacaaaataaaacatttttaggtgactggagcatcattcgctcgtcgtcgtcttccagtcgtgatgagaaatattggaatgtgtgaatcagtcaaaactgcgtcagatctcgtggagcagggacacgttcgaatcggaacgaaactggttaccgatccagcatttatggttacacgatcgtctgaagatatgatcacatggacgaaagcttcgaaaatcaagaaacacgtcatggattataataatactcgagacgatttcgatctcatggattaatttttgtttgtttttaaattttgatttgttgctgttgttgttc