Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C48B6.6   

sjj_C48B6.6 RNAi (8)
PCR_productsjj_C48B6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C48B6.6a Source_evidenceePCR876WS150 Sequence/Annotation Release
C48B6.6b Source_evidenceePCR876WS150 Sequence/Annotation Release
Overlaps_Gene C48B6.6 Source_evidenceePCR876WS150 Sequence/Annotation Release
Chunk_score Abs_score755
Max_abs_score755C48B6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69079936909159
Overlaps_transcript C48B6.6b Source_evidenceePCR876WS150 Sequence/Annotation Release
C48B6.6a Source_evidenceePCR876WS150 Sequence/Annotation Release
WB_DNA_textsjj_C48B6.61167aagaactgcttccaaggcaaccagagctgtctcatatcttaatattataataattataaaaatatatatttctgcataatcactcacctagcattagccatttctccgagtgcctccatcaatgattgtcccatgtcagttccgaattcttctcgaacttttctccgtaatccaacaatttccattggttcaccgagaactgccattgaaagtgacattaaacttgctgtacaaacgccattcacgatctttttatcattatctccgtctttttgtctcgcgaaatggctaagagcatttgaaccaaatcgaataacctgaaatttatgacatttaggcttacgtttgaaactataacaaaatcagtaacaaaatataagaattttaagatcatttacaagtccataatatccattgaaatatgcgacaagaagagcaggatagtatactcgattcagccaaacctcacaacttgctgcgttcactgtgaaaaattggcgagaggactgaaatatacgatatttctagacaaaaaaattaagcataccactggaatttcagtcaaattgaaaacggaagaaccaccatgaatggctgagttcataagtttttccaaaactacaatcaattttagaagtaaatgaacacgaagccattgaacggaatatttgagtggtggagattgatttggatcttctgtagatgatttattcaacttcttatcactattctttcgaacaatcacttctttcgcaagtcgtttaatttcatctgcaattaatgaataattatttaactacagctaatttctactcataaaatttgaaatctagttgttaacctactctcaaaagctgcaaaagtctgcattggttttcctaatggtgtcttcattttattcacaatgcaaaagtttgcagtctgattaataatccaatcccatttttcgataaatgtctctggaacgtatgaatcgggtttttcaagcgtacgacatccttgtgtgaatgtttccagtacttcatccatccatgagttttgaccttttctggaactcaatttatacgtagaaaggttttaattatgaactcacttgaaagtagttggtgttgcctgtttcaacaagaaattcgtaattattataaactcttcggctccaaaacttgt