Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C48E7.1   

sjj_C48E7.1RNAiJA:C48E7.1
PCR_productsjj_C48E7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC48E7.1 Source_evidenceePCR405WS150 Sequence/Annotation Release
Overlaps_Gene C48E7.1 Source_evidenceePCR417WS150 Sequence/Annotation Release
Chunk_score Abs_score334
Max_abs_score334C48E7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI62602536262551
Overlaps_transcriptC48E7.1 Source_evidenceePCR417WS150 Sequence/Annotation Release
WB_DNA_textsjj_C48E7.12299attgtatccaaaatgccatcaacttccaaattgatcattttggcaaccatcgcgttgattggcgccgtctctggtcaagaacaacaggcatgcgctgtcaatcaactctttaatggacaaatttgcacgtgcgctccagggtaagagacgcagattgaaatggttcgaataagagatagaaaaatgacaaattgtggtagagtatctgattatgagaatcctctgagacaccactcccatttttcaccaaatttttctattttcaatgatgaaatttgggttccgtacgatcacggtttgataaattaattgatgacggaaaaccttgaaaatcaaaatattaacaagcatttgaatttcgaaaaaaaactatttgcaggtggaatattaaactaacaatagaaatagttaattgaaacagcttttccaactgctagaacaacgttcaaattgcatttagtgtgtttttatcaaaaataacatattccgatcaactcaagaaactttgatgcaaacgatcaaacagccaagatatgggcggattaaatgtgaaatttggaacattatcaatctaaaactgattttaaacggactaaacgtaaaaaactatgctatataagattagaaacatctgaacaaatataattgaattcgaagaaaacacaagaaaacattctcgaagtacgatccacccatttcttggattttcgtctttttgagtttaattttcatttaactatattacgttttgttcctaaattgaaataattaattgaaacaaattggcacaatattcttacaattgatagaatcttttggaatcagggtgcaaaaattcatgaagtcattctgggtttatcttcaaattaagatactttttttgaaattacatgtcaaaggtaccttttttaattttaaatttcttttcattttgcaacatttgacattttgcaacaaatttcgacagaaaattccaccaaaattaactgtccacttacctccccatctctctctctctctgtctctcaacccatgtttccttttttcagatatttctcttcagccaacgatgactcaaaggcgcgttgcgatgatgaatgtgaagaggtaatgaacggaacaaaatgaataagaatactcaaccggtttcacatatgttgcaggtgtatttctccgttttcaccaccggaaagtgtgtggacaacatctttggcaaagtgccaaaggatcaacaacctgcatgtaatttgagatgtggagtgagtttatttcaaagaattataccaggaatatataaaatattttttttaaaaagtatttcacaaacttgaaaaacatcgttttgtgcaaaaacatcgttaggtatgatactcttttaaaacaatatcatactagtatttaaattatagcctcctagtatttaaattatagcctaaaaagttgcaatattcaaaaacataaaattccacacttttttaaacgaaacatgtctcaactgaaatgtcataaactaaatgatttcaaaaatgcaaaactcactttgtgcccccgaaattttgcctggaaaaatttcagtacattttaaagtttacttaaaaaaccgtagagttaaatactccaaaagcgtggctggatgatttaaaagtgttaagtatattcaatctctgttgttttccggtttttagttttttcagaaaagttttcagaatgctgtgatatttctatcttcgtgttctgtgtaacagtctcacagttttacaaaattacaatgatgagaaagtcgcgaaattaaaaaaaataatcttataagttaacttgacaatattataattgacagatttttccgagttaaaaaatacacatttttaaataatataaatttcagatcagaattcgtctttgggcaaccattgctgcattcgtcgttattgctgctgctctcgtatcccttgttcttgctcttccaatgtgtatcgcatcttgctcagcctgtttgaatgccaaaaaggtcagtttatttaaatgttgaaattaaaactaaaccgtttttacgacatcgctagatatctagtgacataatctctgcctccttttcatccgttcattcacccatttgaacctcattttgcctcttttcatttttaaatagaaaaagagaggaataagtggacactctcttgacatcaacgagattttttgaaaaaaaaaacatatggaagaaagtgtctattttgatgaaaaaatgggaaagaaatgagaagtaatgggtagaggaacttgacagtttggaacatgttga