Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49A1.1   

sjj_C49A1.1RNAiJA:C49A1.1
PCR_productsjj_C49A1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC49A1.1 Source_evidenceePCR741WS150 Sequence/Annotation Release
Overlaps_Gene C49A1.1 Source_evidenceePCR741WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699C49A1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1421396914216191
Overlaps_transcriptC49A1.1 Source_evidenceePCR741WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49A1.12223aaaagacgcagacttttcaactgattttgcaaggttaagagtgtgctgacgtcacattttcctgggagaaaaattcccgcttttttgttttgttgtagatcaaaccgcaatgaggcagcctgtcgccacatggctcctatatgtagtttcaaggatttaaaagtttatttccaggaatactgttcgaaaaaaaagttcgagcaaaaaatggatcagaagcgtgaagctctcgttggtccaatcacaagttctccagcttcaattctagaactttcaattttctatgaattcctaaaagcccagtggtgcgcctttacaatcggctcatcggagcccccaatctcaccgagacagcttaaccttctctccttactaataggaccctctaacagtgatcaggagattccacgtgacacggttgctgtttcctgggtttatgtaggattcgagtttggggagagctgtgagcaatttggagcaactgatgagcagctgagaggtcattttgagtatcaaatgatttgcacaaatgttcaatgtatttattttgtggaggatgggaagaagcgacggatggcaggtgttacttggtatcttagaaatggtgagtagtctgaaaaaaaaaccgcttgaccgcgacgcgaccgcaacgcacccaaacccttagttttggtctaacacttcgaaattttgaaaataggtagctaaaaattacaaaagtttgcacatgaaatttccgggaaattatgcagttttgagccaagttacgtactttaacacttggccgcgacgcgaccgcaacgcattcaaatttttaattttgtttgagcatctcaaaatgtcgaaaactggtagctagaaataacgaaatcttgcattcgaaattaacaattttgagccaagttacgcgacaattcgatgaagacttaaccgcgacgcgaccgcagggcatcattttttaactctagaacctcagcattcttgaaataggtagctagaaattacaaaagtttgctcgcaaacttttacgcaaaattaacagttttgagccaagtcaagcaacgtataggttcaccggttgaccgcgacgcgaccgcaacgcatcgaaactttaaatttttctaaaacctcaatattttaaaagtaggatactagcaactagaacagtttgcagataaaattttaggagaattgggcagcttttaaccaagttacgtaacttcttgacagaccatgtgaccgcgacgcgaccgcaacgcacctaaattgacaatttcattctagatttacagaactttataagaatatagccagatacttcataaattcagagacaaaatgttgaggcgattggctaaaaatcaacctagtaataacgcatcggaaaatacaaaaaaccgcgacgcgaccgcgacgcgccccattttttttttgaaaaaccaccaattacaaaaattttcagatgaaaaatcaaaaaatcacgaggattacaacatgattgctatctacgaaacaataagagagaagagatttgaagaagtgcagaaaatcagaaaattagaaaaagaagaagctctccgccgaggtggatggctcggggagcccactgacgagtacacctctacaatattctcacatttgaagcttctcactctgaaagacggaagattggcagtttttgcctgtaatgctgatggcgaggaggaaaaatttgcgtttaacgagcgaacggagaggtatgaagttttagaagatgttgtagaagttgaagatcgacccagtaattatttattaaggattatatagttttgacttgaattttagattttttgagtaattttatttaataaatttttgcatttcccatgtatttatcaattttcagacgtttaggccaagtttagacacagttatgacctattgaacatttgagcacgcggcgcggtcgcgtcgcggtcagagccaaatttttcttatgcaatgtttacggtacctggatttcttttcatatatcaactttcagacgtgtatcatagttttccattgagtcatgaccaattaaagatttgaagattttgtgttgcggtgcggtcgcgtcgcggtcgcactacggttaattttatagttttctgtgtaatgtattttaatgcatgatgcctttttatatttcaattttcagaagtctagcatcatttcacgtcccattacggtttgatctacaaa