Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49A1.5   

sjj_C49A1.5RNAiJA:C49A1.5
PCR_productsjj_C49A1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC49A1.5 Source_evidenceePCR976WS150 Sequence/Annotation Release
Overlaps_Gene C49A1.5 Source_evidenceePCR976WS150 Sequence/Annotation Release
Chunk_score Abs_score855
Max_abs_score855C49A1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1423754614239787
Overlaps_transcriptC49A1.5 Source_evidenceePCR976WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49A1.52242atccaacttccaaatcgtgagtatttttcattcaatacggttatataatagtattattcccctactacagtcttggtaagaatgcattagccttcacaatggctttagatcaatacagtcacagtatgaaaaaccacaagtttacggttctcggctacaactcgacacattcaacggaatccattgcaacttcacaaacagaaggaattcgaatatgtcgatatgttacattgatggcgaggactaatacagtagataatttggagaaaattaaaattgagtcaaatggggtttcggttgaggtaaggggccccactcttcaacaatctttaaaaaaaattttttttttaagattccgttcaaaatcgcgcgatatactgcaccgaagcctgtcatcatatgtatctctccacagtttgcagcggagcagtggcaaatgtttctaatgcatgttcatgtggctaacaggtaaaaagtagcagggctctatgcagtgtcgtgttgcgactaaaagctagatatggtcaattcaaaactagctcgaatgggcttaaactggcttaaaacaaggccaagactagtttaaactagtctaggctagacaaaaccagctcaaaattgttcaaattaaattaaacaagttcaaagtctaaaccaactgaaaactagctcaatatagttttaactagctcaaagagctttatctattcacaggtaaaacagactagcttaaactggtcaagactggctaaaaagttcaaactaattcaaaacagctcaaactagtcttttttctataatctaaaaaactagctcttagctagctcaaaactagctccaactagtctaaaccagctgaaaactagctcaacctagtcttaactctagctcaaagagctcaaagtattcactattagctcagactagcttaaactactcaagactggccgaaaaagttcaaactattataattcaaaatagcttacactagtctacactagcaaaaaaccagctcaaactagtctaaaatagcttaaaactagctcaaacctaggccaacactagttcaaactagtgtaaaccagctgaaaactagctcaacctaatctcaactagctcaaaaagctgaaactattcaaaattagttcagaccagctcaaaaagtttaaactatttcaaaatatcttacactaatttacactagctgaaaaccagcttaaactagtctgaactagctaaaaactagctcaaagctagtttaaactagtctaggctatccaaaaccagctcaaaatagttcaaactaagtcatagcaagctcaaactagcctagatccgctcaaaacttactcagaactggttcaaactagctcaaaactagcttaaactagcgcaaactagtctgaactagttgagaacgagctctaactagtttaaactagtctgaactagctcaagcctagctcaaactagttccacgttatactagttgcagtccgaattattatgatccatactgtacagattcggaggtcatctccacatctatctcacatcaatcatcgaatcatatttcaagctaatgaaggaatatgaacgtcaaggctacataactctagactactggctgcgtatgaagttctcggaccctaaaactccatacattgagccgaatgaaaatgttgagtggagacatcaagcgggtgcacaaacggattgtctacttcaatacaaggaagccgcagaatacattgcgttttttgatatggatgatatcttgttcccgaaggagtacccgatctatctggaagagttcaactcggtacttgcagcacaccccggcaccaattacttgttttatgggagaagggagcatgaatttgttaaaggtatgggtatgggtatatgggggtgttaaaacataggtacccacttaattcgctcaatttcagcctcaactctgtccgacttcagttttaccgaccttgtcaaaagtctccgttcatctcaaaccataaaaaatggaaaagtcgttgtaagacccgatgcatacaattccacgtggatccacaatagccagcatgtcagtttcgatacgaggtgctatatacgacttaacagttcaaacttaacagtagtcttgtttcagtgttaaagtgaaaagtccatcattggtacatgtgcagctgccggttgataaaaatgggaaaaggaatcattctagggatttgtggaagattga