Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49A1.6   

sjj_C49A1.6RNAiJA:C49A1.6
PCR_productsjj_C49A1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC49A1.6 Source_evidenceePCR862WS150 Sequence/Annotation Release
Overlaps_Gene C49A1.6 Source_evidenceePCR862WS150 Sequence/Annotation Release
Chunk_score Abs_score736
Max_abs_score736C49A1.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1424624314247294
Overlaps_transcriptC49A1.6 Source_evidenceePCR862WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49A1.61052gcattctgacaaaactcgcattttcagtaagcatatcctaaacagattcactttaagatattaatttagaaccagaccccacagaaaatgatattgatccacggcgcgccaatgatctacttcaacttcaccgagaaaactgccacctgggaaacttgcatcactacctgctacagtagcccgggctgtatcgtagcaggatttgaggatggaatctgtaaactgtttgagattggtagtatctcaacaatcaagagattggatgcgaattccgggaagcaggtggcagtgaaggtaagaaaaacgcttgatggggtttcgttttaggatctgtcggatctatgtggattcagatcatctccaacttgaccagctgcgcctctaccgcagctggaaactccttgcaaagtctgatagaacctgatcaaccctacaacatcaccatatctctggacacctggactatccggcagcctcccaagtgcccggagaacttccaaatctttgagagaccgttagggtcatggtgcatcggggtaggcttaacagaaataatgttgcctattgttaatgttcaggtaatcactcaacaaaaagccactcagccagaaggcaccaggtactgccgggaggtgtacaatggagttcttagtggattcgataataacacggagaaggaatttgttgtcagtaagtatcactttctaaggttaacaatgaattatcgggttccagagagcacaaagggtacggtagccagtggaaatgggtaccaaggcgatgcatattgggtgaatggggagcggaagagcagttgtatgtggaaaaatcaaactgggccggactgtgagggagttaaggtaatatgtcattgatcttctagaagcaaaattttcattccaggccttcacaataaccgacccactaatctccacgatctcctacaattggggtgattatgagccaagtgggatgattgataaccagggtacgagcaattgtatagtgtttcgagttggtagaacagttggaagagggactgatgatgcacc