Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49C3.3   

sjj_C49C3.3 RNAi (5)
PCR_productsjj_C49C3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC49C3.3 Source_evidenceePCR417WS150 Sequence/Annotation Release
Overlaps_Gene C49C3.3 Source_evidenceePCR417WS150 Sequence/Annotation Release
Chunk_score Abs_score354
Max_abs_score354C49C3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1731906617320070
Overlaps_transcriptC49C3.3 Source_evidenceePCR417WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49C3.31005cattcaaaattctttttcgttcggttttttacgtcatcgatacaaattgagcgacaccatttctggaaatcattttggaaaactcctcctcggagcattttgtcactatatcaaggcagcgagaatcgtttgatgtgtgatgaaagcgcttacacgaaattccaaagtgttatgaatcatctcatgaacaaagaataataaaaatcaataattttattttgatttaaggttaaagatttaacatttaatggtctacttctttcttcccttctcgccagaagtggcagcgacagtagcggtgtcaatgacgaggatgtttggacatcttcgaagagatccgcagtgtggtgagctgggtcatgaaggcttccctccgaatgatggctcatgatatcccttgctaagacgtgtgatcttgccgttcttgtcgttctgaaaatattgcaaattggatttggcaccagatcaagatattcatcgtccctaactttctagccagaactgattttgctggaaatagccacttagcttaccttgaagtacttgaggacggcgtacttgaccttctatttttcctctttgtaatggtgtaggccttcttcttccttttcttgagtcctccgagaagctgacagttgacgtgacgtgacgtagatgacgtagatgtagattagacgtagagggtagcctcgattccacaatcgctatttccgagctgacaactgaaacagggatatattataaatttgtccggtttttcgagaatcgcgtgaaaggaaactgaccggcatagcagagtctctgctccttgactgggattccgccatggcttcgttgttttgcttggtgctcgagacatcgttgttggcggcgacatcgaagaacaaagttctgtagagtggcttcacgaaaaccataattgactgaccctagttccctgaaaatatcatatttgagtgaaatttctgatccgaaattcaaacaacaaaaagaagtaaccgaacg