Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49H3.11   

sjj_C49H3.11 RNAi JA:C49H3.11
Simmer:C49H3.11
PCR_productsjj_C49H3.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C49H3.11 Source_evidenceePCR949WS150 Sequence/Annotation Release
Chunk_score Abs_score886
Max_abs_score886C49H3.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV79252807926383
Overlaps_transcript C49H3.11.1 Source_evidenceePCR949WS150 Sequence/Annotation Release
C49H3.11.3 Source_evidenceePCR833WS150 Sequence/Annotation Release
C49H3.11.2 Source_evidenceePCR933WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49H3.111104agcaggacattgacaagattcatctgaatttttcttcaatacaataaagcataaaaattgacagttcatttccaaaagtgttaaaacataagtgctcattattatataaaatgatccacattaacagatttattttaacaaaaggaaatatttccacaatttaattgcgggcaaggtactcgtgatgacgctggtatggcgacttctcgagggcctcctccttccagaggtctggggtaaggtaggagtaggttctttggagggcagcataggtagccttggcgaagtttccaagagtggcggtggatcccttagcggcggtgtagcaatcctcgattcctgccatgtgaaggagcttctttggaactggagctgacacgattccggtaccacgtggggctgggatgagtctaaccattacggaggcgcactttccagtgaccttgcatggaacggtatgtgggagtccgatcttgttaccccagtatcctctgcggactgggacaacggcgagcttggcagcaacgatagctccgcggatggcggtagcaacttctttggagcacttgactccaagtccgacgtgtccggcgtgatctccgatagcaacgaaagccttgaagcgggtacgttgtccggcactggaaattataaccccataataaaactaaaaaaataaactacttacgtggtctgcttctggactggggagatcttgaggacctcgtctttaaggttggagcaaagggcgtcgattatctcgaactccttgattggaagggagttgaggtagatctcctcgagggttgtgatcttcttctccttgacgagtcttccgagcttggtgactggagtccattcggtctccttctctcctccgcgtccggctctgaaatttaaatattcaaaatctgaaggtttaagaataaaataactaccttcctccgcgtccaccacgtcctccgcggccaccacgtcctccacgtccagctggacgatctccggctgggcgagcacctccgcggccacctccgcgtcctccgaatccagattggaagcctcctctatcggccatattgaaatgtgtacctcaagctgcaaaat