Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49H3.3   

sjj_C49H3.3RNAiJA:C49H3.3
PCR_productsjj_C49H3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC49H3.3 Source_evidenceePCR330WS150 Sequence/Annotation Release
Overlaps_Gene C49H3.3 Source_evidenceePCR454WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV79243317925302
Overlaps_transcriptC49H3.3 Source_evidenceePCR454WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49H3.3972gtctcgtgcttttcacatattccctcgcttgtttttcagacaaaatggcaaaaagtttgagatcaaaattcaagagaagagttcgtgctatcgccagaaccaagaaggaaccaaagacggcagctcttcttcagaaagcaatcgataaacgtgacgagtacgaaaaacaagatgcaggttgcaatttaatcaattaaaatcaatcttttattatttattattatttcagaaaaaacaaagaccgatggaactgctaatgaagaaaaggttggtaaaatatatctcatcagaagtaaatttcgaagttttttagatggaagtaacatctcaggctacaatcaacacaaagaccctcaaaaagaaggatggttcattcccagcatggctctctggaacgtacgtttttttcatcatgagcgcaaatattcattaattaatacttatcaatcaattacactttcaggcagaagaaaaaagccgcgaaaaagagtaaagcaatcaagaaagcgaagaacaagtctggcaaaaacttcctatgatcttactgataaacgtacttgctgttttatttttttttgttcgttattgttgccttgttgttcatgaaattttcaaaatttatcatttcttcggtttcgttctacagattttatagacctcaaatttgaaagagaatgatgcgcatgaaaacgtttgacaactcggccaatgcaatgccgagtgatatatcaaagtcaggtcaatttacaattgaggcaaattgccgactaaacccaactgttggcagaaatataccgaattcggtgcatacgaggtcaaaactttggctttttctgagaacctgattagtttcccttttaggtgaagaaaatttgttcatccttgaaattttcgaaatcagaaatacactacggaaagggaaaattaaattcaaacttctgactgacatagcaggacattgacaagattcat