Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C50F2.1   

sjj_C50F2.1RNAiJA:C50F2.1
PCR_productsjj_C50F2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC50F2.1 Source_evidenceePCR812WS150 Sequence/Annotation Release
Overlaps_Gene C50F2.1 Source_evidenceePCR812WS150 Sequence/Annotation Release
Chunk_score Abs_score749
Max_abs_score749C50F2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38937473894931
Overlaps_transcriptC50F2.1 Source_evidenceePCR812WS150 Sequence/Annotation Release
WB_DNA_textsjj_C50F2.11185tgcagctttacgcatgattctctcattcctccttcaaatatatctatcatgtttcaggtagtaatttgtataattttgtaacatctgacatccgtcttttaaatgaagcgacactcaattcttcggttaatttgcaggcttattatttgagtttgaataattccgctgacatcaattgcgctctcaatagtattcgtgatcatcttgaaactcaacaagtaaatgaaacagaagatgctgatatttctgaatgtttgaagcaacttctacgattagtgaaaacatcttatgtgaaagcgacagaatatattattgtgaagtgtttgattgaactttcaaattttttttctttgaaactaatcacgtcgttgattgttggaatgcaattgtaaaagtatttaatacacttctcaacttctcaacttctcaacaatttgagtattcaaaactatgctggaccgcaatggagtcacttacaaagcaacatactttccttgggttctactcacaagctctttcgtttctgtcaaacttgatttacggattggcatcgactgaaattgaaaaaatggcaaacaatagaagaaacataactcgtcttttggaaattttaaggtgtggaaatgacttaaaaaacatggattattgtataagcgcaaccaaagttctttataagatggtttggactagtgcaaatgctagattatctatgatagaattaggaggattcaagatcctgttcgacgctattaattcattcaatgatgaatttgttcatcttaatattctcgatactattagagccgttatttcctatgtgtcacttaagacgtgtcaatttttatgtaccgacgatacattttctgtcttcatgtcagttgtctaccagggccgtgcggcaactgagattttcgacaaccggcaacttctgattgccgaaatttcggcaacttattggcaacaggcaaccaggtttcaaagttgtttgttgtttgacattgatataggcaattgccgaagttgccgaacgctgaaaacttcgccaaccggcaacttggttgccggttgccgcacagtcctgtgttatgcctcatcaaaatttcactaacaatattattttgcaggcgaattcttgaagagtataacggagcgagagcgtatcaagcgtacatcatcctcgcattg