Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C50F2.6   

sjj_C50F2.6RNAiJA:C50F2.6
PCR_productsjj_C50F2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC50F2.6b Source_evidenceePCR701WS150 Sequence/Annotation Release
Overlaps_Gene C50F2.6 Source_evidenceePCR705WS150 Sequence/Annotation Release
Chunk_score Abs_score642
Max_abs_score642C50F2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38982723899397
Overlaps_transcript C50F2.6a.2 Source_evidenceePCR700WS150 Sequence/Annotation Release
C50F2.6b Source_evidenceePCR701WS150 Sequence/Annotation Release
C50F2.6a.1 Source_evidenceePCR705WS150 Sequence/Annotation Release
WB_DNA_textsjj_C50F2.61126atccgaagtctgatgggatgaccacttgacgacgttctccctcgcacattccagtcatggcaatgtccattcccttgatgacttcctgtaaaataggggtttttggaaataatttaaaaattgggtgtcaaaggtggtatataccattgtatatttgagcgctgtatcttagaatatgctagttttaactaggtgatagagcgggcgcccctctcccggcccatgaatagttagaacgtctataacatcctaattgatctccagaaatcacgccaaagttatacgtagatcaaaagaagaagcatttcatcaaacattatccgaatgcatcaaactttacgcgcaactttcccaacacttacattattattcaacttgaagatgaatggagcgttgcgagaaaaagacgaatcgacgaaagttccgtcctcaagatgaagcacgtactgttggtgaatggtgtctccactcttcgacttcttgcacttatcctcatcaatcttgtgtgtctgctcaataacgattccctcatcggtggtccacttctctcctggcacagcgcggaacagatcgacgagctggacggtgtagtagagggtctgatcctccttgatgttgtcacgctcacgtcccttgtctccgaatccgaggtttcctgggatgacgacctttctcttttctcccttgcacattccggtcatagctctctccattcctgggatgacctgtccttttccgagggtgaaggtgtatctgaaaatgtcgattagaactgtggattttctttagtttttgggagctcagtaaccctctgaactattttttctaatatcttgcatctaaaaactcacggcttcttgttgaagttggatccgatttcctttccatccttatcagaaagcttgtaccattgatcgagaacatccccgtcttgcgacttgatcgggcacttctcagccttgatcggcctgatgatcttgatctcaagaccatcctcatccttccattgaagcttttgctcctcggcggcaaagcagtacgctgctactatcaagcacagaagaatgacacgcattctgaaaagttataagtaagaggagaaacagggtgaagccaagacgagaag