Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54C8.2   

sjj_C54C8.2RNAiJA:C54C8.2
PCR_productsjj_C54C8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54C8.2 Source_evidenceePCR788WS150 Sequence/Annotation Release
Overlaps_Gene C54C8.2 Source_evidenceePCR788WS150 Sequence/Annotation Release
Chunk_score Abs_score662
Max_abs_score662C54C8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1244525212446447
Overlaps_transcriptC54C8.2 Source_evidenceePCR788WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54C8.21196ccactttgcattccgaatctcaccatctcaatccgaatgcccaatgattcaagttcttgggtatcaggattgtgccacatttttacagaaaagcaagcagctccttgaggaaattgaggactcttttcaaatctacccgataaacctaatgagaaatattgctcggcgcggagcaaagtcggatttacacttgataatcgatacagatatgatgatgagcaccaactttgcaaagatggtaaaaccaatcgcaaatcggatgattgatgggaagaataagcaagtgttggttgttaggtgagcctgattatcaagattacaggacattttcaaagtaatgttgggtttcagacgtttcgagaccaacgaaaatgagctaccaatgagctttggggatcttgaggagggaattgaaaatcataagtgagaaattagtatttatagatcaatcagcaatccacaaaaagtttcagaacattccagttccatcacaaattctttttcgttggtcatcaaattcccaacttgatggaatggttcgaaagatctcacgcctctaatgatgtggtggcatgggagattccatacacgtaggttcttttccatttcacacgtagtgccaggctctcccattacggtttgatctacaaaaaatgcgggaattttttgcccaaaaaatgtgacgccaacacgcattttttgtagatcaacgtagatcaatccaattgggacactctgacaccacgtgattttaatcatgtattataattttgaaaaattttcagtggaaatgattgggaagttcaaatcattcttcaccgcaacgatccatataatgtagagtattttccttcgcgagtcaaggatatgcagtctttggttagtcagaagctctagttaactttgccagaagatcggtgtaggcacaaacacctttctctttcagatctacaagttatgccgtgcaaactacaccttcaatttgctctctcatgtgttcaatgttcataaaggaatcaaagaagatgataccatgtactcgaaggttgtgactgctcacacaaaacggcaaggaagattgaggtatggaaagttagaccatacaaacgtacataacatttataggacgctttctcgatatgtcactgaaattgacaggaaatacccggataccatgaaacgatgtgggcagtttt