Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54C8.3   

sjj_C54C8.3RNAiJA:C54C8.3
PCR_productsjj_C54C8.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54C8.3 Source_evidenceePCR801WS150 Sequence/Annotation Release
Overlaps_Gene C54C8.3 Source_evidenceePCR801WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Max_abs_score717C54C8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1244730812448273
Overlaps_transcriptC54C8.3 Source_evidenceePCR801WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54C8.3966gaattccggcaagtttttgacagaaattccaaggtcctccgcgagaattccagtgagaaatacgtcttctacctgtagcattgaatttttaaatcaaattttaagcaggaacccgaggaacccacttgaataaaatctcgatacttggtagacttgatgatctgctgagcagcctcccaagtgaccatatacaacattcccgagacatactcggggaatttggagcaagagtaggaagactccgggacatacctaaacttggaaaatgagcgatacttcgaaaaatgagtagacttaccatcgatgtgtcttgtcacggaaaatgttagctccggactgcatttttaaaccgtaaattctaagtggagtggcatctatgaaaccttgatcgtagagctctgtaagcttatccgggaagaacatgacgtcttcgtcgattttcccaatcatctggtaccgtggagctttgctgactccgtagagaaggatcgccagcgactgaaagatagtaaaggattttctcagcttcattctacacttgagcaaaaaacttcaataacttaccttataggtgagctcttcgtaattatcattcatgtcaacgacgataatgtccccgtagagctttgcctcttgcatgaccattttcttcattttatattcaccgggcgtcaatccaaccaagaacaacggcttcattctcccatttgctacaatttcgctgttagctttactcatccaggtctgccgcaaaatattcctccgagcatagctatctgtcctcgaagcgactattattagaatatccttttcttgacttgtctcttcaatctcaggaaggtagagccagctatagttcctgtgaatatctgcgaatgaaatcacaaattccgagccaaaatcttgagtttcaggtgatgttgagttatccagccacccattccttgtgcaattttcccttgcaat