Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54C8.9   

sjj_C54C8.9RNAiJA:C54C8.9
PCR_productsjj_C54C8.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54C8.9 Source_evidenceePCR240WS150 Sequence/Annotation Release
Overlaps_Gene C54C8.9 Source_evidenceePCR240WS150 Sequence/Annotation Release
Chunk_score Abs_score219
Max_abs_score219C54C8.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1246089112462089
Overlaps_transcriptC54C8.9 Source_evidenceePCR240WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54C8.91199gttgggaagacaagtatgaatgctatcaaaaattattgaattaatatacttagctcactatcagcggaaggagaacaaggatgtcgcttgaactttaatacatatgataagactcacaagtacagaaaaacaaaaataaaactaaaatgagttgaactaattattttcatttgtcaagataccggtgtaccggaagaaaaaataaataaaatcataactagacaaataaataatatgaccaattagaccagatatgtatagtccgggaggtcaaaaaaatattgtttaacttcaattgatccataaaacttcgtttttaattttttgacaattcttgttttggaattttcaggttaactgtaaatcagactgtttccagacaatggaattaaaagtatggagtttttcaggttttttcgttgaaatgttaagattgttcaccaactgtttgattgtattccttcgaaagttttttactgttagccgatcaagatataatgttaaatcttatgaatcttgtaagattattcagcagaacttagagtctagtaaaacggaaaaaaaaccatatgattgtttcaatgtgctttcttttacagctttgtgcatatgttttccatatgattctgatattttgatcaacacgattttgttttgaaactgaaactttgtttttcattttaaagaactatacaaaacaaaaaaattatataaaaacccaaccctagagtctccaaaatccccaacaaagcatgaagcttctcattcttttctccctcttcgccatcttcttcggagtcattgcactggattccccaattccggagttctactccactggaagatcaaccagggtcccatcccaccgacaccggatcccaagactcggaaaacgtgaagttccaaactttcaagctgacaacgttcctgaggctggaggacgagttcgcagatatgtaggaccaccgctcaaattggttatattaatttaatgtctaaatattgaataaagacgtacatgcagaaaagtgcaataattcatttcagacctaatttcgggtcctgccactcagactacagtactgctcggatatttgttcattgttccctaactgtttgatttgtactccctagcctctagtttttgaccattaaatcacctgaattatgcaaaataaacagtcaaaaacacgaagcat