Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54D10.10   

sjj_C54D10.10RNAiJA:C54D10.10
PCR_productsjj_C54D10.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54D10.10 Source_evidenceePCR603WS150 Sequence/Annotation Release
Overlaps_Gene C54D10.10 Source_evidenceePCR603WS150 Sequence/Annotation Release
Chunk_score Abs_score499
Max_abs_score499C54D10.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1245137612453052
Overlaps_transcriptC54D10.10 Source_evidenceePCR603WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54D10.101677aatacaattcttgagtcccggttgataagcatatctaccataatgtttgaatgcaaggcgttctgatccagaagaaactggaagtgaacacacatgatcaggataaggacaacagaagttcttctttgtacaacgatagcctgttggacagccattgtcacatttttgagcttttgtgactatttttgcgtcggttgggagtttacaggcattcactggaaaatatagattatatttttaattcatttgaattaacttgaattaacttattttcaagagacaacatttggcaatttcttttaaggccaaagaaattcagtaagtgttgtcaaggtttggaaaatgttaaattaatattaccaattaagctcatatccttattaacttgaacttcttcttcttcactatcttcctcatcatcgtcagtttctgcttctccatcatcttccttcttctctggtttctttgttttaccgggcttatgtggaacacaagcatcactacaagcatctctgctctcaaatcgattctcgtttcctccacatcctcgatagaaaagaggttggcacacgtctgaagtgtatgttcagaattgaatattatcaggttatatgaaattttgactattttactgatctaaaaattttatttcaatttgtttgactccatataatgtaattggtttcaaaataaggtcaaggattttacccggaacttcaccacgttttagaggcccgtagaatggctccaaatatggttttagtaaattttttatggttttataggtttgaaggaaaacaatctggaagcttcttgaaaagttactatttttagcaaaaagcttaacattttttcgtccaactccggccaaaaagtttttcatagacattaaaaaattacaatcacaggtattccaactcagctgaagctctgaaagcttgtattatctgactacttgcgtacaatgaagcctcgcaaaaatggaaaagttttattggtacttccaaaatataaatataaactcacttgttctcatatcaaaataaaatttcaatgtaattggtttattatcacagttgacaccggtatccttctcctggcggcagtttatagcagagactaaaaaatatttcggaaattttaaatagttaaaattgtatcctacctgacgatatacaacaaagtaataaaaatatagatatgaactgcattttacctggaaatttttaaaataaaatattcaagttattgagtttttctattttaaagtgaagaaaaacttttaaaaaagaaaacaaataacaatttggcaactgccatatatctaaggtcatttcaacttgagaaactcggaagttttacaattcagatgaaaatacaatgatattactagaagaaggtcttttactaacaatgggaagacccagaacaatgttcaatagtgtgaaaagacgtaaacaggaaagtatgcaaaggtcgaatggtcgagatggtattgttcttcttcctctttttttcatttttctgcttcgtttggagaataaaaggggaagttaacaaaattttgaaaaaaaaagaagcttcaagtttacatttcatattatgttccagtttacacagtgggtggaaatgaagtaagaccagggtttgatcaatagatcacgaccctcaagttga