Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54G4.3   

sjj_C54G4.3RNAiJA:C54G4.3
PCR_productsjj_C54G4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54G4.3 Source_evidenceePCR721WS150 Sequence/Annotation Release
Overlaps_Gene C54G4.3 Source_evidenceePCR721WS150 Sequence/Annotation Release
Chunk_score Abs_score616
Max_abs_score616C54G4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80052018006323
Overlaps_transcriptC54G4.3 Source_evidenceePCR721WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54G4.31123tagaagagttgttggcggatttagaaaacgaagtgtatgcagaagtcgaaaaactgctctcaggaccgctgctgtatttcaagggaactccagatgtagcagtattcgatgcaattctcgagatcattgtgtggaagttctggaataattcaggttattgaggtagaaagaagttaatgagcacaccttgttagaggcagcatctctaaaaacacgcatctctccagccaacagtttagcttcttccatgacctttgaattggaagatttcagaccatagaggccctcaattgctccacggaaggcttttccaatctgacaaatgatatttgaattggtatatcttgatgagctatcaaaaagttatcaactaacaaaatggcttctgtaaaatttggaatatattgtcagttgataactttttatatctatacttccagctgagctactatcgttcacaactcacagcttgttcatcagttgcatgggcctccaatgcatcttgttccttcttttccgtacgatgcaccatatcaataacttgatccattaaatcattcatatcaacgtccttctcatatttataaaatgacttattcacttgaaccactgattcttttaggatgttgaccttcttttccaatagttggacatctttgaccatcaatgtagaggctaactaaaatgagaatgattaaatgctgaagcttgtgtgttcaaaaacctttctcaggaaaattcttgacttaccgcttgatcagcagtagccttagccttctccattttctgattcatccacttcgaatttccagagcggtccttgtgaatttgttcatccaactcatgcatcattccacgaatacgatcgaaatcttcattcattgatatttgcatatcacgaagttccaaatcagtatgacgacgaactagttcaccttcacgaattgattcgatcgctttttccgttgcattcagactacgttcgatcatttctttttgggaattctgaaaggttgattgtttttaaacccataattacagtcgaaaaagttaaaaacttacatgcttgacatccatcttaacaatcaattcctgacagggacgaccaacttgagaataatcg