Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54G4.4   

sjj_C54G4.4RNAiJA:C54G4.4
PCR_productsjj_C54G4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54G4.4 Source_evidenceePCR872WS150 Sequence/Annotation Release
Overlaps_Gene C54G4.4 Source_evidenceePCR872WS150 Sequence/Annotation Release
Chunk_score Abs_score788
Max_abs_score788C54G4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79983017999715
Overlaps_transcriptC54G4.4 Source_evidenceePCR872WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54G4.41415acacgtgtaattcgctgctgactcgaaagttgatgactcgacatcaactcttccatttgcaatcaaaggaggtcttccacagtctacaagctcacatgtcggctctgatccactccatattccatctgattgacatactcgacgaagtgatcgataagatggagatggcgagttggcaaggtgccaaccatttgaacattcatattctacctgaaaataaagttttagaaatgttttagggagaagctctttgactactaattaattgattttcaaaggaacgctttcaaaaaatcgtctcggtggcatatttgattgatcgatggcatatttacaaacatttttttaattgctcaaaaactgcgtcggtgttgcaatgtgttaagtttttgattacaattttggcaagacaatcagaaaaaagatttttccgagggcgctggataaaatctgccgcatatctctgatatactcccttttcagttgcgcggaaaattaacgtaggaatcggtgactttgaaaaattacttaaaaaataagtacgtaattcacatttataatagggaaaaacagtaaatttcactcatcaacaaaaaaacatacttcactttcgaaaagagtcgttttgttcagaagctttattcttccgaatttccattgccttactgctccgcacgattttcctgaacaattgaaattttcaatctagatttttcaaatcccctataaaacgtacgataacaattcggtatacttccagtccatcttccattctctgcgcattctctttgtctaattccatgaagatcatatccagaatcacaagaataaaaacataatgttccaatcgcatatgaatgtgacgaaaatgtgactttagtggcttctcctactcccggtgaggtacaaaactttggtttcgattgacataaaaatgagttccatgctgtttgagatgcgggaacccatttccattctagtggacgtgcaagaagaacagcttctgaagcagatggaactggagatggttgacccggccaatcagcactatctccaactccttcaccatcaacccatctccattcagtcattgatgatgatgctccaatccaataaaatgcttttgctgaagatgaggctgatagagctgatcgaagacctcttcgagtagaatcatcaattcgaagtggaagagttgatcctctgtaaccattcaataaagtgtttgagaaataactttcctagtaatataagcttagattgtcttatagttgttatatgatcgaaacaagcttcttacctgtccagacattttctctgtgcacccaaccaatcggtttgctcatcacgacttgctgcatagcacattccaccaaaaactccaacaacttccatttgactctgagcacattgcc