Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54G4.5   

sjj_C54G4.5RNAiJA:C54G4.5
PCR_productsjj_C54G4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54G4.5 Source_evidenceePCR360WS150 Sequence/Annotation Release
Overlaps_Gene C54G4.5 Source_evidenceePCR393WS150 Sequence/Annotation Release
Chunk_score Abs_score309
Max_abs_score309C54G4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79954367996591
Overlaps_transcriptC54G4.5 Source_evidenceePCR393WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54G4.51156tattcttgtccgtcctcctcatacatctagatatccatttcacgtcatttggggactctgctggagacaacgtcaaagcaatgctcggaaattaattttcaaagcggttaggtatttccgccggagagttctaaagtcgagaagaatagtaattattatgattcagtcaagttgttgactgaaaatattggaaaataactttaaaattctgcaatttctatgctctttgttcacttcttttcaattgttccattatttacgtctacccgactaagcagcaattgttcaatttttcagatgtgaaaagttttttctcgcaaaaaaaactacaaaatgcaccttcaacgaccaccttcatcatttactacgtcaacttctgcaaaacctgatgttgcatggtcatcttttttaatggtttactcgtaagttttcttaaggcggagtattgtcaataggggacttgttgtttaaaccgatagtactaaaatatttgaacatcaaagtgaaactttaaaaaggctttttaacttttttattagcattcaaaaagtgacgaaaaaagagttttcacctatcgtaattttggaatttgagtaaaaactttttttaattttggaagtttggcaatttaccaaaatattgactggacattttgaaaaatctacaaatttttgaagcgtttaattatgatattcggaactattgtacaccttgaatacacacacttaaaaactctatgcttcatcaaacgtagaatactttaatttcagaattccgtttatattggttctcacagtggcgtgcattataaagtggcgaccaatgagggaatttccaaatttgagaagttttttcaggtaagtacagcatactgtattttttctaactgtccaaactaatattttcagctggtactgctcatgctctcctaaaaaagtgatacaagaacttgaacaacctgatcgtacacatatgataatgtcaattgacgcacaggtatttagacttatagtttttttttgttccattgatagtattagtttcagagtcttgcatcaatgtcttcagttattgattcaccacttcttgtccgaaggaatgaagaagaaagtcgaaagtttgaatcaactgccattccctgacctgattttcaaat