Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54G4.8   

sjj_C54G4.8 RNAi JA:C54G4.8
Simmer:C54G4.8:Screen_A
Simmer:C54G4.8:Screen_B
PCR_productsjj_C54G4.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C54G4.8 Source_evidenceePCR824WS150 Sequence/Annotation Release
Chunk_score Abs_score698
Max_abs_score698C54G4.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80232938024410
Overlaps_transcript C54G4.8.2 Source_evidenceePCR824WS150 Sequence/Annotation Release
C54G4.8.1 Source_evidenceePCR824WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54G4.81118tttctgcgacttcgtgaatgaccagatatgtctctttccgtagatcagcacaacagccacaaatggaatcagagcagcgatctaaattattaaagtttattcacttgtatataatattttctaaaatgaattaccttaagagcccacttctttctggtgtcatggaatggctctgcggcccagtgcatgaatgcagaaacatccttagcttgttgagacattgttgctggtgttccgtccttgtactcaattccttcgtcgaacaattgttgtggcatagagatgatacctcctgggaagtatggattgtaagcttttccgtcatcaacctgaaaaatgtttcactaattcctttcaattgtgtgcacgaaataccttcactccagctggagcctcaagatatccagtaagaagagagaaaacgtaatcatctcctccgtgtctagcaagagccatcaatgacaaatctggtggagcagctccgttgttggcagccgctgcggccttcttgtttggatatgggtttggcaacttatcggtcagcattcctgggcgctgaatggatgctcccttatcgtcaacatcattaataagagcgtcagcggcctcggctttagcttcttcctttaaaaaaaagtcgtgattagcatgaagttattattttattcaaattacctcagtcatgattgtgtcaacgaaatgacggtaatgcaagaatttcatcgagtggcaagctgcgcacacttgcttgtatacttcgtatccacgtcgtacactgaaacatgaacgatttatcattatccaaactcaattgaacctacgaagcaatgtcgaatgaagagaacggtccgctgtgagcccatggtaaagcgtacgggtgaacgttgtctccgctagcgctgaccgagttctccaaagcgtaaacgagtcccatgcctgaagcggctgtgactccggcaagggccgccaatccacgctgaaaaatacgataattaattcactgtttatttcaacataaattattgtcttctaataataattggagtttttgaatagaaaggacataaaacttactttagatccttgaaccacggcacgctgcattacgtaccacgtcg