Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55B7.2   

sjj_C55B7.2RNAiJA:C55B7.2
PCR_productsjj_C55B7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C55B7.2 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score811
Max_abs_score811C55B7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65090316510221
Overlaps_transcript C55B7.2.2 Source_evidenceePCR874WS150 Sequence/Annotation Release
C55B7.2.1 Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textsjj_C55B7.21191ggccaacgagcaaaaactaaatatggcaaagaaatcagatcatggtggaccacttggtgaacttcttcaatggtcggatcttcttgcaacactttcagttattggacatcatttggaagtttcaactaataagaatactcttagaaagtatgaaagtatttaatgatttggatgaaaacttattctttcagtattgtgtggaagtatatgagcagaggaccttgtcaatatgttaataattttcgtcagcagttggatatcattttcacagatattatgggtttcaacattttaagacaacatcatagacagtttttattgagtaataggtgagtaaattctttttccaatagacttacaactttttcctttaaaagaaaattccttgttttcttttcagatgtcgaattaggcttcttgacagttttggaacacatgcagaattcactacaaaaacttatttcgtacaaaataagaaatctctatctggaccattttctcaacggaatccatggggaggtcatgggttggatcttcgtcaacattggacattttatccacattctgatgataacacatttcttggatttgtagttgatactgagggaattgataaaaagaataatcagatgatcccatcagctctggtatatggaaaagagcagtatatgtggagagacgcagagaaaccaattgatgttttgaaaagaattgtgactgttcattctacggttgctgacttagatttgaaagacagtaatataagttcaatattcaaaaaagttcaaaatcacggttttctgaactctgaagaaatatcacaactacttgataatatcacaatattctttggacttggcttcccattagaaggacctgcaccactcgaagcaatggctcacggagcagtttttataaatgcaaagtttaaagaaccaaagtcgagattgaattataagtttttggcggaaaaaccaacattgagaaaggtttgttgttttctaatttttgaaggaatttcaaaaattgtcagtcaaagttttgctaaattgcctaattttccaaaaaaggcggacttctcaaataagtcatttcgagtagactaaattttttaatgtaatttttacaaaattaaaaattaagaaaacgttttattttgatatttatgtgaccagtttagccggtttttga