Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55B7.3   

sjj_C55B7.3RNAiJA:C55B7.3
PCR_productsjj_C55B7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C55B7.3 Source_evidenceePCR888WS150 Sequence/Annotation Release
F10G8.1 Source_evidenceePCR864WS150 Sequence/Annotation Release
Overlaps_Gene C55B7.3 Source_evidenceePCR888WS150 Sequence/Annotation Release
Chunk_score Abs_score489
Specificity_index0.392
Rel_score0.644
Map_statusBest_ePCRI65001216501249
F10G8.1 Source_evidenceePCR864WS150 Sequence/Annotation Release
Chunk_score Abs_score759
Max_abs_score759F10G8.1
Specificity_index0.608
Rel_score1
Map_statusTop85_percentile_ePCRI1001978210020909
Overlaps_transcript C55B7.3 Source_evidenceePCR888WS150 Sequence/Annotation Release
F10G8.1 Source_evidenceePCR864WS150 Sequence/Annotation Release
WB_DNA_text sjj_C55B7.3_11128cagagagtgcaaacagcagcaccaaatcgtcggtgctcgatgaaccaacactggttgagcggaaacaacaaaagaaacaggtaaactattttgatttttttaaatataaggagcctcgcagtacatcaaaaaaactaccataccatctcccattaaatataaatctgtttcagatcttgaagttcgttcagcgtacactggaaaagatgccacaagggcttcgcgccgagttcgttgggatgagacgcttcaacgattttgagaaaatgaaagcgttcaaagaagctcaagaagctggaaagaaccgctacaaagacgttggatgccttgacaacaatcgtgtcaaactggaaggaccatggccgcatgaatacattcatgcgaactacgtggcaactccaacgaacccgaaaagattcatctgcacccaggccccattggagaagacttgtgccgacttttggtacatgtgctatcaagacaaggtcgagtacatttttatgctgtgcaactttctggagaaaggagcaaaaaagtgtttcgaatacttcccgagcaagaagggtgatgtgatggactttgacgaaggtggtcagaagatctcagttaaatgcgaatcttcggtgacggtaagttctattctttctcaagtttgaatagttcattgaaagttttcattattcgttccgtgctgatgcaaaggcaaacgtcactgcaacagagattgtgatcgaaggacctggcgagaaaactcgaaagaccactcattatcactggaatgactggccagatcgcggtgttccagctgcggatatggctgttcttgagcttctggagaatgctagaccatcaaagtaagttgatgtctgtgtattgtgtcgagatgcatttttatgtattttcagaggtcctatcgttgtccattgttctgcaggtattggacgcactggctctgttgtgatgttggagtacatcatggatcaactgctcgcaggccagatcattgatgatggggaaaagatcttggtcaaaatttgcgagcaacgtaacaattcaatccaggttgtttgcagactgtacatgcatttttacagttttattattttcagacggatgcccagtatctgt
sjj_C55B7.3_21129cagagagtgcaaacagcagcaccaaatcgtctgtgctcgatgagccaacactggttgagcggaaacaacaaaagaaacaggtaaactattttgatttttgaaaatataaggagcctcgcagtacatcacaaaaactatcatactatctcccattaaatataaatctgttgcagatcttgaagttcgttcaacgtacactggaaaagatgccgcaagggcttcgcgccgagttcgttgggatgagacgcttcaacgattttgagaaaatgaaagcgttcaaagaagctcaagaagctggaaagaaccgctacaaagacgttggatgccttgacaacaatcgtgtcaaactggagggaccatggcctcatgaatacattcatgcgaactacgtggcaaccccaacgaacccgaaaagattcatctgcacccaggccccattggagaagacttgtgccgacttttggtacatgtgctatcaagacaaggtcgagtacatttttatgctgtgcaatcttctggagaaaggagcaagaaagtgtttcgaatacttcccgagcaagaagggtgatgtgatggactttgaggaaggtggtcagaagatctcagttaaatgcgaatcttcggtgacggtaagttccattctttctcaagtttgaattgttcattgaaagttttcagtattcgttccgttctgatgcaaaggcaaacgtcactgcaacagagattgtgatcgaaggacctggagagaaaactcgaaagaccactcactatcactggaatgactggccagatcgcggtgttccagctgcggacatggctgttcttgagcttctggagaatgctagaccatcaaagtaagttgctgtctgtgtattgtgtcgagatgcattttaatgtatttttcagaggtcctatcgttgtccattgttctgcaggaattggacgcactggctctgttgtgatgttggagtacatcatggatcaactgctcgcaggccagatcattgacgatggggaaaagatattggtcaaaattcgcgagcaacgtaacaattctatccaggttgtttgcagactgtacatgcatttttacagttttattattttcagacggatgcccagtatctgt