Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55C2.2   

sjj_C55C2.2RNAiJA:C55C2.2
PCR_productsjj_C55C2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC55C2.2 Source_evidenceePCR330WS150 Sequence/Annotation Release
Overlaps_Gene C55C2.2 Source_evidenceePCR360WS150 Sequence/Annotation Release
Chunk_score Abs_score318
Max_abs_score318C55C2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI25624412563382
Overlaps_transcriptC55C2.2 Source_evidenceePCR360WS150 Sequence/Annotation Release
WB_DNA_textsjj_C55C2.2942ggtgcaactctacatttaaaccgttaaattttaatttttactatttttgttttcaaggtatttgttaggaataaaaattttaaaaaagtttaaacaatttctcgtgtacaacatgaaaaggttatttagtacatcttgataagaaagggtatagatacttggcgaaaaccgtaatcaaatcagtcttcaaattgccagtaccaaacgaccaacaacccaagctgcaacatgtccctcactgccgatccaccagcctgcaccgtaccagctgccggagtttcctccacccacaagctcgtcaatggtggagccgagaagatcgtcttcaagatcaaatcatcgaacaacaacgagtaccgcattgcaccggtgttcggatttgtcgacccatctggatcgaaggatgttgtgatcacccgtactgctggtgcaccgaaggaagacaagctggtcgttcactttgcatcagcgccagctgatgctactgatgctcaagccgcttttgttgcagtggctccagctggaactgtcaccattccaatgtcggccaccgcctaaagagcacttattttgcagcatttatttaagatggaaataaacctttttgtggagctcgtttttttgttttctcgatcctaataagatcttataaaaaggttccatgcatctacaatggagaagcacctggaagagtttgcaaaagtgaatttggcttggggtgtggtagaaagatacactgttcccctcgagacccaatgcggcaaaacttgtcgaggcggcaattcctacccgttttctaccctcttcgcgtgtcatgcttacatcagatagaaaagattgacattcacaaatttattcttgcaaaaatttcttccaaattcttcaaaaacatttaaaaaaaaggtatttttacagtacatgtacctcgagtttggaaatgtt